1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gavmur [86]
3 years ago
10

Identify The following DEPENDENT VARIABLE in this experiment using this research question: What is the effect of the number of h

ours the soccer team practices on the number of wins they achieve in a season?
Biology
1 answer:
olya-2409 [2.1K]3 years ago
6 0

Answer: Dependent variable = number of wins

Explanation: Dependent variables DEPEND on another event or causation to affect them.

If you practiced 0 times, you'd likely wouldn't win any games.

If you practiced 20 times, you'd likely win many games.

The wins depend on the practices.

You might be interested in
1.3.4 How can teenage pregnancies be avoided? List FIVE ways.​
Anika [276]

Answer:

Don't have sex. 5 points isnt a lot so I am not spending alot of time on it.

8 0
2 years ago
Read 2 more answers
I need help please ?!!!! Asap thank you (:
dangina [55]

Answer:

Replication

Explanation:

Replication is not a type of DNA mutation

3 0
2 years ago
The movement of water from high to low concentration across a semipermeable membrane is best defined as:.
andrew11 [14]

<em><u>The movement of water from high to low concentration across a semipermeable membrane is best defined </u></em><em><u>as</u></em><em><u> </u></em><em><u>Osmosis</u></em><em><u>.</u></em>

<em><u>have</u></em><em><u> </u></em><em><u>a</u></em><em><u> </u></em><em><u>great</u></em><em><u> </u></em><em><u>day</u></em><em><u>!</u></em>

8 0
2 years ago
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
Juan visits his health-care provider complaining of a persistent cough. The provider focuses on the cough and believes the only
Aleks04 [339]

Answer:

This should be the correct question with the options.

Juan visits his health-care provider complaining of a persistent cough. The provider focuses on the cough and believes the only cause is a bacterium and that antibiotics will fix it. What type of health care does Juan's provider practice?

A. behavioral medicine

B. conventional medicine

C. Ayurvedic medicine

D. self-care

B is the ANSWER.

Conventional Medicine is the treatment of symptoms and diseases using drugs, radiation or surgery.

6 0
4 years ago
Other questions:
  • 24.<br> What is the purpose of natural selection?
    13·2 answers
  • Hey, can you tell me
    14·2 answers
  • What three factors does a species diversity index take into account?
    14·1 answer
  • Which particle in an atom tells you the atomic number?
    14·1 answer
  • Constant high pressure in an area in summer will MOST LIKELY cause a
    8·1 answer
  • What happens during the lysogenic cycle
    9·1 answer
  • The skeletal system is the framework of the human body, comprised of bones, joints, and connective tissue. The integumentary sys
    8·1 answer
  • YO PLZ HELP!!!!!!!<br> What are three functions of the nervous system?
    6·2 answers
  • Which of the following best describes bear hibernation?
    6·1 answer
  • How can external systems cause climate forcing??
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!