1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oliga [24]
3 years ago
14

Which body part from other systems does not interact directly with breathing?

Biology
1 answer:
Stels [109]3 years ago
8 0

Answer:

The process of physiological respiration includes two major parts: external respiration and internal respiration. External respiration, also known as breathing, involves both bringing air into the lungs (inhalation) and releasing air to the atmosphere (exhalation). During internal respiration, oxygen and carbon dioxide are exchanged between the cells and blood vessels.

Respiration begins at the nose or mouth, where oxygenated air is brought in before moving down the pharynx, larynx, and the trachea. The trachea branches into two bronchi, each leading into a lung. Each bronchus divides into smaller bronchi, and again into even smaller tubes called bronchioles. At the end of the bronchioles are air sacs called alveoli, and this is where gas exchange occurs.

Diagram labeling the major structures of the respiratory system

Diagram labeling the major structures of the respiratory system

Image credit: Arteries and veins of the body by OpenStax, CC BY 4.0

An important structure of respiration is the diaphragm. When the diaphragm contracts, it flattens and the lungs expand, drawing air into the lungs. When it relaxes, air flows out, allowing the lungs to deflate.

Common mistakes and misconceptions

Physiological respiration and cellular respiration are not the same. People sometimes use the word "respiration" to refer to the process of cellular respiration, which is a cellular process in which carbohydrates are converted into energy. The two are related processes, but they are not the same.

We do not breathe in only oxygen or breathe out only carbon dioxide. Often the terms "oxygen" and "air" are used interchangeably. It is true that the air we breathe in has more oxygen than the air we breathe out, and the air we breathe out has more carbon dioxide than the air that we breathe in. However, oxygen is just one of the gases found in the air we breathe. (In fact, the air has more nitrogen than oxygen!)

The respiratory system does not work alone in transporting oxygen through the body. The respiratory system works directly with the circulatory system to provide oxygen to the body. Oxygen taken in from the respiratory system moves into blood vessels that then circulate oxygen-rich blood to tissues and cells.

Studying for a test?

Explanation:

You might be interested in
Which of the following is not one of the five main groups of arthropods?
Vitek1552 [10]

Five major Arthropod classes

Arachnida. mites, ticks, spiders, scorpions.

Chilopoda. Centipedes.

Crustacea. (crabs, lobsters, shrimp.

Diplopoda. Millipedes.

Hexapoda. Insects.

so your answer will be mollusks

4 0
3 years ago
Read 2 more answers
Second-order neurons of ascending pathways that contribute to sensory perception terminate in the ________. Second-order neurons
madam [21]

Answer:

The correct answer will be option-Thalamus

Explanation:

The somatosensory pathway is the pathway which sends the receptor generated sensory impulses mostly the temperature and touch to the central nervous system.

The pathway is composed of three types of neurons called primary order neuron, second-order neuron and tertiary order neuron.

The second-order neuron receives the signals from the first-order neurons and carries the signals to the relay part of the brain called thalamus. The thalamus is present in the forebrain region of the brain where it receives, analyses and sends the signals to the different region of the cerebral cortex.

Thus, the thalamus is the correct answer.

7 0
3 years ago
What are some negative aspects of plate tectonics
Masja [62]
Earthquake, volcano and continental shifts
6 0
3 years ago
How should the researcher classify cell A and cell B
Sphinxa [80]

Answer:

All living objects are composed of cells, including you. Cells are the basic element of existence. Such cells are known as prokaryotes and eukaryotes. Procaryotes are cells not possessing a nucleus, or organelles comprising the genetic material of a cell, or other membrane-bound organelles.

Explanation:

8 0
3 years ago
Which of these are not embedded in the hydrophobic portion of the lipid bilayer at all?
hodyreva [135]
Do you have any answer choices

4 0
3 years ago
Other questions:
  • Q 3.83:Which of the following would both viruses and bacteria have since they can both evolve?
    15·1 answer
  • List and describe five things you and your classmates could do to conserve water in your school.
    10·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following is a nonrenewable resource?
    7·2 answers
  • What is Laslow's hierarchy?
    11·1 answer
  • What is the full form of ATP ?
    12·1 answer
  • A gene encoding one of the proteins involved in the DNA replication has been inactivated by a mutatiion in a cell. In the absenc
    7·1 answer
  • Sr.
    9·2 answers
  • Humans release solid waste in the form of feces this is an example of
    15·1 answer
  • Identify the dependent (responding) variable WILL MARK BRAINLEST!!!
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!