1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andreyy89
3 years ago
8

A biochemist isolated and purified molecules needed for dna replication. Whne she added some dna, replictation occursd but the d

na molecules were defective. Each consisted of a normal dna strand paired with numerous segments of dna a few hundred nucleotides long. What had she probably left out of the mixture?
Biology
1 answer:
liberstina [14]3 years ago
3 0

Answer:

She left Ligase enzyme out of the mixture.

Explanation:

DNA replication is the process of formation of new molecules of DNA from the existing one. This process occurs in semiconservative way i.e each new strand consist of one newly synthesised strand and one old parent strand that act as template for the formation of new strand. replication on one strand occurs continuously from 5 prime to 3 prime but on other strands it occurs discontinuously from 5 prime to 3 prime because DNA polymerase moves only in one direction from 5 prime to 3 prime. Hence in discontinuous strands gaps remained. These gaps are filled by Ligase enzyme.

Requirements for DNA replication:

DNA replications needs

Primers

DNA Polymerase enzyme

DNA helicase enzyme

Single nucleotide binding protein

dNTPs

and Ligase enzyme.

Correct choice:

She left Ligase enzyme out of the mixture.

You might be interested in
PLEASE ANSWER ASAP!!<br> Why are the strands of DNA described as complimentary?
hodyreva [135]

Answer:

The nitrogen bases can only pair in a certain way: A pairing with T and C pairing with G. Due to the base pairing, the DNA strands are complementary to each other, run in opposite directions, and are called antiparallel strands.

Explanation:

8 0
2 years ago
"1. which organelles work together to transfer energy (from solar to glucose to atp?
Lyrx [107]
The answer is chloroplasts and mitochondria.

<span>When solar energy in the form of sunlight reaches a leaf of a plant, it passes through the leaf to chloroplasts. Chloroplasts contain pigment chlorophyll which is excited by light. As the result, </span>a series of chemical reactions occur in the chloroplasts and carbon dioxide and water are converted into glucose and oxygen. Now, glucose is broken down and transported into mitochondria where through different processes (Krebs cycle and electron transport chain) energy is produced in the form of ATP.<span>
</span>
6 0
3 years ago
What is the corpus callosum, and what happens to a person after having surgery to sever it?
ziro4ka [17]

Answer:

See the answer below

Explanation:

The corpus callosum corresponds to a leaf-shaped structure, being a group of nerve fibers that join both hemispheres of the brain (right and left). This structure is formed by axons covered with myelin, which make up the white substance. The functions of the corpus callosum are: transmission of information to both hemispheres, participation in vision (in eye movement), learning, information processing. When performing surgery on the corpus callosum, syneresis, comprehension disorders may occur

This procedure can be used for epilepsy.

5 0
2 years ago
What kind of problems will we face if our body had no muscles ​
sertanlavr [38]

Answer:

musculer system is important part of our body. Muscles hold our bones together and helps them to move.

so if we don’t have muscles in our body, we won’t be able to move. we won’t be able to open and close our mouth. eyes etc. we can’t move our any body part.

no smile, no cry, and even we would not be able to breathe.

Explanation:

7 0
3 years ago
Which of the following is a normal constituent of urine? (choose all that apply)
Savatey [412]

Answer:

A and C

Explanation:

did this question before and got it correct

3 0
3 years ago
Other questions:
  • How can karyotype analysis detect genetic disorders lab 12-2 answers?
    14·2 answers
  • What type of fertilization requires a great excess of egg and sperm gametes because most are wasted?
    12·2 answers
  • HELP FAST!!!!!!!
    7·1 answer
  • Plants that are more rare today are _____.
    14·2 answers
  • Male sperm and female egg are diploid cells
    15·1 answer
  • 2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
    14·1 answer
  • How many full-length strands of hair are collected from the scalp to use as a sample?
    8·2 answers
  • What is the term for mold getting its nutrients
    10·1 answer
  • A pollen tube is essential to the process of pollination because _________________________. Select one: a. it creates pollen b.
    7·1 answer
  • The ordered pair (24, 6) is a solution to which equation?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!