1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zhuklara [117]
3 years ago
10

24. A limiting factor for a field planted with corn every year is most likely -

Biology
1 answer:
Dafna11 [192]3 years ago
3 0
A

Planting the same crop over and over again depletes the nutrients of the soil and it also allows any pests to get used to the soil. That’s why many people practice crop rotation.
You might be interested in
A cell with 22 chromosomes undergoes meiosis. How many nuclei result from this process? Need ASAP
qaws [65]

Answer:

The overall process of meiosis produces four daughter cells from one single parent cell

Explanation:

Germ cells contain a complete set of 46 chromosomes (23 maternal chromosomes and 23 paternal chromosomes). By the end of meiosis, the resulting reproductive cells, or gametes, each have 23 genetically unique chromosomes.

8 0
2 years ago
What type of fungi is a catfish most similar to?​
marin [14]

Answer:

The most common fungal diseases of fish are saprolegniasis, disease caused by Achlya, branchiomycosis, epizootic ulcerative syndrome (EUS) and ichthyophoniasis

hope it will help you

7 0
2 years ago
Which is NOT part of the cell theory?
atroni [7]

Answer:

B.

Explanation: Hope this helps! ^^

8 0
3 years ago
At which one of the following days in the 28-day cycle is a woman MOST likely to get pregnant?
motikmotik

Answer:

The answer is day 14 - / + 3 days

Explanation:

In a 28-day menstrual cycle the most likely days for a woman to become pregnant is from day 14 - / + 3 days, that is, days 11, 12, 13, 14, 15 and 16. She should be educated, If she is in search of pregnancy, take the vaginal temperature and realize how the viscosity of the abundant flow begins to present.

4 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
Other questions:
  • How would the genetic traits of a population change in response to an environmental pressure such as overfishing?
    12·2 answers
  • How do the cells produced by meiosis
    7·1 answer
  • How is the energy trapped by a plant, stored and then released several days later?
    7·1 answer
  • A client reports that she has a terrible headache that doesn’t go away. the client keeps asking what time her son will be in to
    15·1 answer
  • A mutation creates a dominant negative allele of a particular gene. The normal allele of the gene encodes a protein that forms a
    11·1 answer
  • Why does the Moon have a greater influence on Earth's tides than the Sun does?
    5·2 answers
  • Which of the following organisms have increased the amount of oxygen
    10·1 answer
  • White fluffy clouds form high up in the sky is an example of what
    9·1 answer
  • · Label the Plant Cell​
    14·1 answer
  • The following reaction is of photosynthesis:
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!