Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
It is the winter solstice. T<span>he solstice that marks the onset of winter, at the time of the shortest day, about December 22 in the northern hemisphere and June 21 in the southern hemisphere. I know this mainly because I had the same question. Good luck :)</span>
Answer:
The abyssal plains of the eastern Atlantic Ocean stretch from the continental shelf to the base of the mid-ocean ridge.
Explanation:
The others are false
The latitude of scott lake's shoreline is 25.9411999 and its Longitude is -80.232269 on the griddle map.
<h3>What is a Grid coordinates?</h3>
This refer to coordinates of a coordinate system to which numbers are assigned for use in designating a point on a griddle map.
On a grid map, these Grid coordinates are used to locate an exact position of an area on the map.
Read more about Grid coordinates
<em>brainly.com/question/20362114</em>
<em />
#SPJ4
5 prayers a day
Salat al-fajr: dawn, before sunrise.
Salat al-zuhr: midday, after the sun passes its highest.
Salat al-'asr: the late part of the afternoon.
Salat al-maghrib: just after sunset.
Salat al-'isha: between sunset and midnight.
