1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tanzania [10]
3 years ago
5

A cell is round and it is not able to produce it's own food. Which of the following organells does this cell have?

Biology
1 answer:
Savatey [412]3 years ago
6 0
Cell wall A. Is the correct answer
You might be interested in
Which is not a compound?
Allushta [10]
Hi! What are the possible answers?
6 0
3 years ago
Read 2 more answers
2. The Agawam High School band is playing some lively marches while the coaches are giving pep talks to their respective footbal
laiz [17]

Answer:

the tuba player is over heated

Explanation:

wool mostly conserves body heat. especially in warm weather...

6 0
3 years ago
1. What is the connection to Lake Okeechobee and the red tide in south Florida? (Explain)
anyanavicka [17]

Answer: this year, after heavy spring rains and because of discharges of water from Lake Okeechobee, river runoff in southwest Florida brought a large amount of nutrients into near-shore waters of the Gulf of Mexico, which fueled the large red tide.

Explanation:

8 0
3 years ago
Identify the correct statements regarding the the treatment of fractures. check all that apply.
lapo4ka [179]
<span>The treatments for fractures are pretty common to include plenty of bed rest. Using cold compresses very frequently, taking any prescribed or over the counter nonsteroidal drugs for pain relief as needed. As the area starts to heal start to do either home based or physician recommended physical therapy to get the fracture up to par.</span>
3 0
3 years ago
Leo has been learning about wind, douds, temperature, and precipitation in school. What is the name for the long-term temperatur
Tems11 [23]

Answer:

C- Climate

Explanation:

Climate is those patterns over a long period of time.

4 0
3 years ago
Read 2 more answers
Other questions:
  • How are sperm cells transmitted? And how does a condom prefent sperm cells in transmitting?
    7·1 answer
  • Which scientific term is used to describe a testable model that seeks to explain natural phenomenon
    8·1 answer
  • A single piece of coiled DNA is known as a?
    14·2 answers
  • Which of the following is NOT a mental health professional?
    6·2 answers
  • please help :) In an experimental investigation, the variable that the researcher changes or manipulates in order to see its eff
    5·1 answer
  • (( EARTH ScIENCE ))
    11·1 answer
  • A biome is best described as a major type of ecosystem with _____.
    10·1 answer
  • Two people,both with AB blood have 4 children . What blood types should the children be
    5·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Match the pairs-rhizobium-<br>a)nitrogen fixation<br>b) bakery products <br>c) food poisoning​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!