1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arada [10]
3 years ago
11

What does the weak magratic field tell you about the internal structure of Venus?

Biology
1 answer:
igomit [66]3 years ago
3 0

Answer:

The existence of a strong internal magnetic field allows probing of the interior through both long term changes of and short period fluctuations in that magnetic field. Venus, while Earth’s twin in many ways, lacks such a strong intrinsic magnetic field, but perhaps short period fluctuations can still be used to probe the electrical conductivity of the interior. Toward the end of the Venus Express mission, an aerobraking campaign took the spacecraft below the ionosphere into the very weakly electrically conducting atmosphere. As the spacecraft descended from 150 to 140 km altitude, the magnetic field became weaker on average and less noisy. Below 140 km, the median field strength became steady but the short period fluctuations continued to weaken. The weakness of the fluctuations indicates they might not be useful for electromagnetic sounding of the atmosphere from a high altitude platform such as a plane or balloon, but possibly could be attempted on a lander.

Introduction

The existence of a strong intrinsic magnetic field and the presence of time-varying fields can both be used to probe the electrical conductivity of a planetary crust1,2. Based on the Venus near-equatorial magnetic field surveyed down to 150 km altitude by the Pioneer Venus Orbiter (PVO), it is generally accepted that Venus has no significant global intrinsic field3,4. Although strong variable fields are present in the Venus ionosphere, these may be largely spatial variations, fossil fields impressed by slowly changing interplanetary magnetic fields “played back” at higher frequencies by the spacecraft’s rapid motion through the ionosphere. If so, then the fields at the surface of Venus resulting from the diffusion of the ionospheric magnetic field into the Venus atmosphere might be significantly weaker than in the ionosphere and much quieter5.

The Venus Express mission, designed to complement PVO, was inserted into an elliptical orbit with periapsis over north pole6,7. Initially, its periapsis was close to 78˚ latitude north and 250 km altitude. Later, the spacecraft periapsis moved to higher latitude over the pole and then to lower latitudes. Periapsis altitude was variable but typically remained above 160 km. A joint analysis of the Pioneer Venus and Venus Express measurements at low altitude within the ionosphere revealed that the magnetic field was horizontal on the dayside and expanded both into the wake at low altitudes and away from the wake at high altitudes8. During the last days of the Venus Express mission May – July 2014, an aerobraking campaign was performed. The changes of the spacecraft orbit allowed the periapsis to go as low as 129.7 km in altitude, which is well below the main peak ionosphere altitude of ~140 km9,10. Note that the lowest altitude measured by the PVO magnetometer was 150 km

Explanation:

Brian least po please

You might be interested in
Which of the following is a common renewable resource found in deserts
frez [133]

Minerals

Explanation:

Minerals can be found in the cactus and ground and are very resourceful

3 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Does coal releases carbon dioxide into the atmosphere?​
Tamiku [17]

Answer:

yes

Explanation:

Coal is an important source of energy in the United States, and the Nation's reliance on this fossil fuel for electricity generation is growing. The combustion of coal, however, adds a significant amount of carbon dioxide to the atmosphere per unit of heat energy, more than does the combustion of other fossil fuels

5 0
3 years ago
Read 2 more answers
Why is the cell membrane so important?
Nady [450]

C, because it protects the cell from the outside environment

3 0
3 years ago
Which level of Ecology explores the relationships among different species and the environment?
vichka [17]

Answer:

I an expert in Biology, trust me.

I an expert in Biology, trust me.Your answer is<em><u> </u></em><em><u>Ecosystems</u></em><em><u>.</u></em>

<u>Explanation:</u>

<em><u>An ecosystem is a geographic area where plants, animals, and other organisms, as well as weather and landscape, work together to form a bubble of life. Ecosystems contain biotic or living, parts, as well as abiotic factors, or nonliving parts.</u></em>

<em><u>If</u></em><em><u> </u></em><em><u>you</u></em><em><u> </u></em><em><u>like</u></em><em><u> </u></em><em><u>my</u></em><em><u> </u></em><em><u>answer</u></em><em><u> </u></em><em><u>you</u></em><em><u> </u></em><em><u>can</u></em><em><u> </u></em><em><u>mark</u></em><em><u> </u></em><em><u>my</u></em><em><u> </u></em><em><u>answer</u></em><em><u> </u></em><em><u>as</u></em><em><u> </u></em><em><u>Brainliest</u></em><em><u>.</u></em>

<em><u>And</u></em><em><u> </u></em><em><u>if</u></em><em><u> </u></em><em><u>you</u></em><em><u> </u></em><em><u>have</u></em><em><u> </u></em><em><u>any</u></em><em><u> </u></em><em><u>questions</u></em><em><u> </u></em><em><u>do</u></em><em><u> </u></em><em><u>not</u></em><em><u> </u></em><em><u>hesitate</u></em><em><u> </u></em><em><u>to</u></em><em><u> </u></em><em><u>ask</u></em><em><u>.</u></em>

8 0
2 years ago
Other questions:
  • What is the best description of the chromosomes by the end of prophase of mitosis
    11·2 answers
  • Which of the following statements about desalination is true?
    9·2 answers
  • HELP ME!! which of the following statements about energy is true?
    14·2 answers
  • Baby paolo smiles and coos so often and is so delightful that his parents feel compelled to smile and chatter right back at him.
    12·1 answer
  • which of the following statements about scientific theories are true? (A) theories cannot be tested (B) theories are the same as
    7·1 answer
  • During the laboratory, the students laid the food samples on brown paper, like the kind of paper that lunch bags are made out of
    10·1 answer
  • The similarities of a birds wing and an insects wing are evidence of what.
    7·1 answer
  • The presence of a transit sequence directs a protein from the ________ to the ________. The presence of a transit sequence direc
    8·1 answer
  • SOMEONE SMART PLS HELP!!!!! If 1 kg of fuel is used in the above fusion reaction, the resulting helium has a mass of 0.993 kg. I
    10·1 answer
  • Predict the effect of an alternation in the sequence of nucleotide in the -35 region of a bacterial promoter​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!