1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
romanna [79]
2 years ago
14

How much of Earth is comprised of ice? (1 point)

Biology
1 answer:
Likurg_2 [28]2 years ago
8 0

Answer:

<em><u>about 10 percent</u></em>

Explanation:

hope this helps you!!!

You might be interested in
Do viruses carry out all life processes? If not, which are they missing
Molodets [167]

Answer:

No, they only carry out reproduction.

Explanation:

individual viruses don't carry translational machinery, namely, the proteins needed to read their DNA and RNA and build new viruses. They invade a cell and hijack its genetic tools to do it for them.

6 0
3 years ago
Which of the following applies to a viral infection
enyata [817]
Are there suppose to be choices?
6 0
2 years ago
Read 2 more answers
Which sphere allows the human breathe oxygen from the air to the lungs that involves matter starting and ending ?
balu736 [363]
ALVEOLI that’s the answer
3 0
3 years ago
What are invertabrate group includes coral, sea anemones,and jellyfish?
ELEN [110]

The nettle animals. Corals, sea anemones and jellyfish belong to a group of animals called cnidarians (pronounced 'nid-air-e-ans'). ... With 1,048 marine species, cnidarians are one of the largest groups of invertebrates in New Zealand waters.

7 0
3 years ago
Read 2 more answers
Horizontal gene transfer can occur through several mechanisms. Why is this relevant to humans?
Fiesta28 [93]

Answer:

B. Bacteria can exchange genes for resistance to antibiotics in this way.

Explanation:

Even though conjugation requires cell-to-cell contact, it can occur between distantly related bacteria

7 0
2 years ago
Other questions:
  • How do scientists know what the surface of venus looks like?
    6·1 answer
  • Compared with people who do not have schizophrenia, synaptic pruning occurs __________ in people who do have the disorder.
    12·1 answer
  • When you complete a high school program of study, you will earn a_______________.
    8·2 answers
  • Tomas is writing questions to use in a quiz show game that reinforces concepts about the movement of water in the ocean. To whic
    9·1 answer
  • When does DNA replication occur within the cell cycle?
    6·1 answer
  • 4. Koalas are herbivores that eat leaves from
    7·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • When Avery and his colleagues kill the S-strain bacteria and mix the remains with the Australian bacteria, the R-strain remain h
    14·1 answer
  • Eight bones make up the __________ , which encloses and protects the brain.
    5·1 answer
  • 2) How many solutions does the equation 4x + 2(x-5) = 3(2x - 4) have? Write down the final form as well as if it has no solution
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!