1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pie
3 years ago
12

Here are some free pts for you awesome people! ​

Biology
2 answers:
LenaWriter [7]3 years ago
7 0

Answer:

Thank you so much !

Explanation:

AlladinOne [14]3 years ago
6 0

Answer:

thanks

Explanation:

yessssjdbs sbsksjsjsb

You might be interested in
Which statements about the nucleus is not true?
Gelneren [198K]

Answer:

Does not contain electrons

Explanation:

Hope this helps!

3 0
3 years ago
5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
dusya [7]

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand  will be 5'UACGGGCCCACAGCAUAACU 3'

8 0
3 years ago
A plant makes glucose during photosynthesis. Glucose consists of the elements carbon, hydrogen, and oxygen. What is the source o
podryga [215]

Answer:

Glucose is produced by plants through photosynthesis. In this process, the plant uses light energy from the Sun to convert carbon dioxide and water into glucose and oxygen. Algae and certain bacteria and other unicellular organisms also produce glucose through photosynthesis.

Explanation:

5 0
3 years ago
The environment determines the hybridization of an organism true or false? PLEASE ANSWER QUICK
Annette [7]

Answer:

true

Explanation:

just report me if im wrong

5 0
3 years ago
What are negative characteristics of a lysosome?
Zepler [3.9K]
Diseases, genetic problems, tay-sachs disease.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Why doesn’t coral grow well in the water by the Galapagos?
    13·1 answer
  • List the structures and organelles inside the cell that an HIV virus needs if it is to reproduce?
    11·1 answer
  • | ՎuestIVIT<br> The cell grows in these phases of Interphase.
    14·1 answer
  • What is the curie used to measure?
    9·2 answers
  • Im needing help on this asap
    5·1 answer
  • Average atomic mass of strontium
    10·1 answer
  • There are two species of sparrows that appear very similar to each other. A scientist tried to mate them. He observed that in sp
    5·2 answers
  • So can someone answer me this so my G f gave me her em ail and i tried to em ail her with my school em ail and she said she didn
    5·1 answer
  • How can the use of fertilizers affect respiratory health?
    12·2 answers
  • Explain how eating a burger is the result of photosynthesis​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!