Scientists<span> are people who use research and experiments to learn more about the natural world. </span>Scientists<span> use scientific methods to derive knowledge systematically, performing repeatable experiments to ensure that their conclusions are valid and accurate.</span>
Answer: Decomposers
Because, when organisms are broken down and decomposed, they are mixed in with the soil. Yes, you should add soil to a food web that depicts the food relationship in an ecosystem because not only is it a result of decomposition, it helps the producers grow, starting the food chain again.
Answer:
Cooperation
Explanation:
Cooperation is a type of behavior evolved by members a species living together in a close-knit society, whereby they all work and act together to ensure the common good of all members. This behavior ensures the survival of the members of the species in any environment.
Cooperation among small birds ensures protection of the members of the group against predators. Also, pack hunting is a form of cooperation among animals of a species to ensure nutrition is provided for all in the group. Se animals also form defensive circles as a form of cooperation to ensure protection of members, especially the weak and young members, against predators.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Human monoclonal antibody (mAbs) are emerging in the field of cancer therapy and have become an increasing proportion of new drugs that are recently approved. Although there are some methods to obtain antigen-specific mAbs from human B cells, it is generally impossible to directly immunize human beings with antigens of interest. For example, for infectious agents, those approaches are largely restricted. To solve these obstacles, two main approaches have been developed; either by humanizing antigen-specific antibodies from small experimental animals (which is laborious due to the great genetic differences from humans) or rely on the in vitro selection of antigen-specific binders from human antibody repertoires. However, the human mAbs developed by these methods are usually with low affinity.
We are now coming up with a much better idea that is humanizing non-human primates mAbs instead of murine mAbs. Due to the close genetic relationship with humans, immunized NHPs have more potential to be isolated with high affinity antibody to human target than other experimental species, such as mouse, rat and rabbit. In addition, with appropriate method, NHP antibodies are much<span> easier to be humanized</span> without any loss of affinity compared to widely used murine antibodies.
Resource: http://www.creative-biolabs.com/High-Affi-TM-Human-Antibody-Discovery.html
