1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksi-84 [34.3K]
3 years ago
12

Which of the following would be found in all prokaryotic and eukaryotic cells?

Biology
1 answer:
jeyben [28]3 years ago
7 0

Answer:

Plasma membrane, ribosomes, cytoplasm, DNA

Explanation:

You might be interested in
What effect did the capture of Vicksburg have upon the Confederacy?
Nina [5.8K]
The effect that the capture of Vicksburg had upon the confederacy was that the states west of Mississippi became completely isolated. The Mississippi valley states were no longer considered a great threat. This also opened the doors of invasion for the states that lied to the deep south. Vicksburg was an important place to capture in respect to its geographical position.
4 0
3 years ago
2 Explain why fossil fuels contain large amounts of carbon compounds.
Korvikt [17]

Fossil fuels release carbon dioxide gas when they burn which adds to the greenhouse effect and increases global warming. Of the three fossil fuels, for a given amount of energy released, coal produces the most carbon dioxide and natural gas produces the least.

Did this help?

4 0
3 years ago
An error in which macromolecule is the cause of hermophia
kiruha [24]
In hemophilia A it’s caused by a mutation in the gene for factor VIII. Hemophilia B is a result in a deficiency in factor IX due to a mutation in its corresponding gene.

In both cases, it is a mutation in the DNA (the macromolecule).
8 0
3 years ago
Which process produces two copies of the original dna molecule
iVinArrow [24]

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

                  Hello!

✧・゚: *✧・゚:*    *:・゚✧*:・゚✧

❖ The correct answer choice is B. DNA replication. DNA replication takes place in interphase during mitosis and meiosis.

~ ʜᴏᴘᴇ ᴛʜɪꜱ ʜᴇʟᴘꜱ! :) ♡

~ ᴄʟᴏᴜᴛᴀɴꜱᴡᴇʀꜱ

8 0
3 years ago
Read 2 more answers
Which of the following is ribonucleoside?
juin [17]

Answer:

E

Explanation:

8 0
3 years ago
Other questions:
  • How do bacteria make ATP?
    12·1 answer
  • If exponential growth occurs in the population of a species of predator, the population of its prey will most likely ?
    6·2 answers
  • Can someone please help me with biology on chromosomes?
    6·2 answers
  • The body of tapeworm is segmented but it doesnot belong to phylum annelidai why​
    13·1 answer
  • What are some services give me like 5 .
    7·2 answers
  • This space station has plants growing inside it, and astronauts who eat the fruits and vegetables from those plants. Because it
    8·2 answers
  • Which of the following exceptions to the Fourth Amendment allow law enforcement officers to search email, telephone, medical, an
    11·2 answers
  • When science alters or clones genes and inserts them into an existing strand of DNA to make a new trait is know as:
    10·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • To what extent should humans manipulate human reproduction or genetic characteristics?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!