Answer:
A. Hemodialysis
Explanation:
Hemodialysis is the method or process of using a dialysis machine (a special machine) to clean the blood.
This is done by doing a minor surgery on the patient to get the blood into the dialyzer.
This dialysis machine does the work a healthy kidney would do.
Answer:
Transamination reaction:
Transmaination reaction may be defined as a type of chemical reaction that involves the transfer of an amino group to the another keto acid fort the formation of new amino acid. The non essential amino acid can be easily converted to essential amino acid by this transmination reaction.
This reaction is important for the important mteabolic pathways of the body. The cofactor required for the transamination reaction is pyridoxal-5'-phosphate. This cofactor also works as a derivative of vitamin B6. This cofactor is converted to pyridoxamine-5'-phosphate during the reaction.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
Fertilizer is added to soils to increase plant productivity. A common type of fertilizer is called NPK fertilizer because of its ingredients: nitrogen (N), phosphorus (P), and potassium (K).
Explanation:
The initiating event in the development of nephrotic syndrome is a derangement in the glomerular membrane that causes increased permeability to plasma proteins.
Nephrotic syndrome can be understood as a kidney disorder in which the glomeruli filter of the kidney gets damaged due to which it is unable to filter the proteins and passes an excess amount of protein in the urine.
Glomeruli filter consists of clusters of small blood vessels in the kidneys that function in filtering the waste and excess water from the blood. It also sweeps the blood protein which is necessary to maintain the correct amount of fluid in the body, from seeping into the urine. But when it gets damaged glomeruli stop sweeping the protein from the urine as a result too much blood protein leaves your body, leading to nephrotic syndrome.
Learn more about Nephrotic syndrome here
brainly.com/question/10125358
#SPJ4
