1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
chubhunter [2.5K]
3 years ago
15

In reality, however, making school punishment more uniform actually worked to:

Law
1 answer:
yarga [219]3 years ago
7 0

Answer:

C

Explanation:

missing vital context. this is what I assume is correct

You might be interested in
Parafrasea la información del texto escogido (texto1 o texto2), es decir, usa tus propias palabras y realiza dos realice dos pár
madreJ [45]

Proceeds to rob your house

4 0
2 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
What is a genotype?
solniwko [45]

Answer:

a genotype is the the genetic characteristic of an organism so im guessing the answer is D. hope this helps you!

3 0
3 years ago
Mutual funds require a minimum investment<br><br> True or false
Stells [14]

Answer:

Although there <em>are</em> mutual funds with no minimums, most retail mutual funds do require a minimum initial investment of between $500 to $5,000

3 0
3 years ago
Read 2 more answers
Suppose an operator of a weight scale certifies the weight of a good that is for sale. However, the accuracy of the scale used t
jenyasd209 [6]

Hello. This question is incomplete. The full question is:

Suppose an operator of a weight scale certifies the weight of a good that is for sale. However, the accuracy of the scale used to weigh the good has not been checked in more than four years, even though the weight scale operator could have easily checked the accuracy of the scale. The scale gave an improper weight measurement that resulted in many problems with the shipping and sale of the product.

The above scenario is an example of what?

Answer:

Negligent misrepresentation

Explanation:

As you can see in the question above, the operators' neglect to adjust the scale properly to ensure the proper functioning and accuracy of weighing resulted in the exposure of incorrect information that hindered the transportation and sale of a certain product. This is a case of Negligent misrepresentation, since there was a display of a false statement due to imprudence, a negligence.

6 0
3 years ago
Other questions:
  • Emotions can influence your driving.
    13·2 answers
  • Gina is 15 and lives in Oklahoma with her parents and 2 siblings who are fiancially well and no abuse or problems whatsoever. Gi
    9·1 answer
  • Difference between Dan and bakas​
    14·1 answer
  • Evidence that is in view of the police does not require a search warrant, but can be legally seized is called _______ ________ _
    7·1 answer
  • 2. The concept of one car length of space between two vehicles for every ten miles per hour is the most current method of comput
    6·1 answer
  • What year did Illinois become a state?
    15·1 answer
  • In three or four sentences, describe why the vice president in a company makes a very high salary while a person who works in hu
    13·2 answers
  • What<br> can Congress do to check the President?
    12·1 answer
  • What's the definition of "Magna Carta", and what's the importance of it?
    10·1 answer
  • Congratulations! You were just informed that you are the new Police Chief in a rather large city where an officer-involved shoot
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!