Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer:
A
Explanation:
I had a almost the same question on my test and got it right.
Similarities between mitosis and meiosis:
Both mitosis and meiosis are processes of cell division. They use the same steps for cell division, including prophase, metaphase, anaphase and telophase.
Differences between mitosis and meiosis:
Mitosis is the process of asexual reproduction, while meiosis involves sexual reproduction. Higher life forms, such human beings and animals undergo meiosis. The resulting offspring is genetically different in the case of meiosis, while the offspring is identical in the case of mitosis. Meiosis includes two steps of division, compared to the single step of mitosis. During the process of meiosis, the number of chromosomes is reduced by half, while in mitosis, they remain the same. Also, mitosis produces 2 diploid cells, while meiosis produces 4 haploid cells.
Hope this helps.
Answer:
5. pycnocline.
Explanation:
Pycnocline is the rapid change in density of ocean water with depth. With increase in depth, ocean water tends to be denser. The two major factors that determine density in ocean water are temperature and salinity(salt contents). The denser water become in the ocean the more likely it sinks easily . This is one major factor that drive Ocean currents, the process is called thermohaline circulation.
The increase in salinity of ocean water causes an increase in density . This is because the salt become tightly pack and filled the water to make it denser . This simply means an increase in saline content of ocean water causes an increase in the density.
Another factor that affects density is temperature. Water at the surface possesses higher temperature due to direct contact with the sun. Usually, the higher the temperature the less dense ocean water becomes . This is why surface water is less dense. As water becomes warm the molecule disperse, this account for it lower density . Colder water are usually higher in density .
Generally, an increase in ocean depth causes considerable increase in density because of it colder temperature and increased salinity contents.
