1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fiesta28 [93]
2 years ago
15

What are the famous appetizers being served during occasions in your locality? Give at least five.​

Biology
1 answer:
taurus [48]2 years ago
5 0

Answer: These recipes range from great dips, fantastic cocktail shrimp platters, or even elegant party crackers. Serve up a great dish of goodies to your guests while ...

Explanation:

You might be interested in
To maintain homeostasis, freshwater fish must ________. excrete large quantities of water take in electrolytes through simple di
11Alexandr11 [23.1K]
<span>Choice (a) is the most correct. Fish must excrete large quantities of water as a way of keeping the homeostasis in their cells. Otherwise, the water levels in the cell could become too high and the cells would likely rupture, leading to the death of the organism.</span>
8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Which of the following best describes an innate behavior that an organism is born with to help enhance its survival? (voice note
Alex_Xolod [135]

Answer:

A monarch butterfly migrating

Explanation:

I think it is the butterfly because butterfly's fly right after they come out of the cocoon  

4 0
2 years ago
Which question is a testable
podryga [215]

Answer:

A testable question is one that can be answered by designing and conducting an experiment. The answers to a testable question can be observed and measured. Hypothesis- a testable explanation of an observation. A hypothesis is NOT just an educated guess about what you think will happen.

3 0
3 years ago
A _____ species has slow population growth rates and long life spans, while _____ species have numerous small offspring and fast
Travka [436]

Answer:

yep

Explanation:

good luck i believe in you

8 0
3 years ago
Other questions:
  • Models need to be changed when _______. a. they are based on experimental data b. scientific understanding changes c. they repre
    14·1 answer
  • Over the last several decades, scientists have addressed the problem of nonrenewable natural resources such as fossil fuels. Hum
    11·2 answers
  • Integrated Natural Resource Management Plans (INRMPs) are mutually agreed upon documents to protect the natural resources on mil
    8·2 answers
  • A _______ describes the location of a cell based on its column and row location.
    11·1 answer
  • Felipe made a toy boat out of clay, but it kept sinking in water. He changed the boat's design by making it slightly wider than
    5·2 answers
  • I need help with # 18!!!!!!
    8·2 answers
  • Knowing that the human body is approximately 60% water, and that some organisms live in water, what is the importance of tempera
    5·1 answer
  • What did Renaisance writers write about?​
    14·1 answer
  • Which discovery supported the endosymbiotic theory?
    13·1 answer
  • What type of traits do autosomes determine
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!