It should be
AGATACCATGGTTACCCGGTTCCA
Answer:
Telomeres cap and protect the ends of chromosomes from degradation and illegitimate recombination. ... Abolition of telomerase activity in such cells nevertheless results in telomere shortening, a process that eventually destabilizes the ends of chromosomes, leading to genomic instability and cell growth arrest or death.
Answer: Polar molecules must contain polar bonds due to a difference in electronegativity between the bonded atoms
Explanation :polarity is a separation of electric charge leading to a molecule or its chemical groups having an electric dipole moment, with a negatively charged end and a positively charged end. Polar molecules must contain polar bonds due to a difference in electronegativity between the bonded atoms
Answer: Q1 = true
Q2 = first is polymer, second in monomer, third is element
Explanation:
