1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Novay_Z [31]
3 years ago
13

The aspect from which a sample is drawn is known as the

Biology
1 answer:
PolarNik [594]3 years ago
8 0

We use samples to perform experiments. When sampling, we take test subjects from a larger group often known as "<em>population</em>" or at times "<em>universe</em>".

Sampling is a term we use to describe the process of selecting a small representitive group from a larger population. Sampling can often be divided in its simplest form into:

  1. <u>Random Samples</u>
  2. <u>Non-Random Samples.</u>

Which as their names imply, represent first a sample that is chosen by not specific method and whose probability is equal for the entire <em>population</em>, and secondly a sample chosen based on specific parameters.

Sampling can then become more complex, being divided into more complex methods such as:

  • <u>Systematic sampling </u>
  • <u>Stratified sampling </u>
  • <u>Cluster sampling</u>

etc.

The one thing all of the sampling methods have in common is the fact that they will all draw their samples from one place. This place or aspect from which samples are drawn is known as the <em>population</em> <em>group </em>or sometimes coined as the <em>universe</em>, to represent the group in its entirety.

To learn more visit:

brainly.com/question/350477?referrer=searchResults

You might be interested in
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
________ carry out specific functions inside cells, whereas ________ store glycogen, lipids, pigments, and other substances.
Sedbober [7]

need the answer pls

Explanation:

8 0
3 years ago
If wheat is sown in the kharif season what would happen discuss​
kirza4 [7]
Kharif season is more of a “rainy season”. So the whole crop might get destroyed due to the lack of temperatures, pests, adaptability.
5 0
4 years ago
Which best describes the diagram?
anastassius [24]

Answer: The Answer is C

Explanation: The deer is eating getting carbon by eating the grass (the producer)

7 0
3 years ago
Read 2 more answers
What is gene regulation
andriy [413]
Gene regulation is the process of turning genes on and off. It is accomplished by a variety of mechanisms including chemically modifying genes and using regulatory proteins to turn genes on or off.
6 0
3 years ago
Read 2 more answers
Other questions:
  • Name two stages that are involved in producing proteins
    7·1 answer
  • Question 4 of 10
    11·1 answer
  • What stays the same in metamorphic rock although mineral composition might change
    11·1 answer
  • People have built canals and levees to divert water away from its natural flow and prevent floods in residential areas near the
    15·1 answer
  • 4. A cell has lost control of its cell cycle and is dividing out of control. (2 pts)
    8·1 answer
  • Why is DNA like a seed
    5·1 answer
  • Suppose you have to bar magnets. Which statement is true?
    10·1 answer
  • The number of individuals divided by an area is called
    11·2 answers
  • I need someone to do a essay for me the information about the essay is in the picture
    10·1 answer
  • Which number identifies the system that serves as the site of nutrient and waste exchange between cells and the interstitial flu
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!