1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elis [28]
3 years ago
6

Explain the difference in meaning between the words microbe and pathogen.

Biology
1 answer:
Ivanshal [37]3 years ago
8 0

Answer:

Different diseases are caused by different types of micro-organisms. Microbes that cause disease are called pathogens. It is important to remember that: A pathogen is a micro-organism that has the potential to cause disease.

You might be interested in
In a small cramped kitchen, you and some friends are preparing a spaghetti dinner. the water is boiling and the pasta is now rea
DerKrebs [107]

In a small cramped kitchen, you and some friends are preparing a spaghetti dinner. the water is boiling and the pasta is now ready to be carried to the sink to drain. you pick up the pot of bubbling pasta water and start in the direction of the sink. the pot holder slips slightly, causing the water to splash onto your arm. the scalding water burns your forearm. you are experiencing a lot of pain, with a red, blistering burn on your arm.

The appropriate first response will be to cool the affected arm under running water and application of ice pack. The cold temperatures will lower the pain that is being felt.

6 0
3 years ago
Mitosis is best described as:
anzhelika [568]

Answer:

A

Explanation:

the first one

4 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Explain how water enter the soil root hairs of the plant
Juli2301 [7.4K]

since the roots hairs grow in soil particles, they get water from the soil, thereby the cell wall and cell membrane absorbs the water through osmosis before transferring it to other parts of the roots

7 0
3 years ago
What is a Cell wall?
MatroZZZ [7]
Cell wall is the outer permeable covering in all pants and almost all prokaryotes ! cell wall are mainly made up of cellulose , sometime by chitin!!
8 0
3 years ago
Other questions:
  • Which predictions made by lamarck turned out to be valid?
    8·1 answer
  • I will give brainliest to best answer!
    15·1 answer
  • Suppose a blood sample tested above the range (6.0 mg/dL) of the standards used in the experiment. What modification will provid
    9·1 answer
  • What is true for all cells
    13·1 answer
  • The mineral graphite is used in pencils. What is the characteristic that allows it to be used for this purpose? *
    13·1 answer
  • What do the phase changes (condensation, evaporation, crystallization) in the water cycle have in common?
    10·1 answer
  • The gene frequency for a particular trait in a population was determined to be 80% A (dominant allele) and 20% a (recessive alle
    9·2 answers
  • Mass measures the amount of ______ in a substance
    15·1 answer
  • Name and describe the functions of each of the THREE TYPES of muscles
    11·1 answer
  • Yea this one i dont know
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!