1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Daniel [21]
2 years ago
6

A ______ is a statement of what will happen in a given set of circumstances

Biology
2 answers:
vagabundo [1.1K]2 years ago
6 0
Prediction is your answer
Anna11 [10]2 years ago
4 0

Answer:

prediction

Explanation:

You might be interested in
3 stimuli that a bird responds to
Luden [163]
Weather condition , temperature , and food ability 
4 0
3 years ago
Why is the percentage similarity in the gene always lower than the percentage similarity in the protein for each of the species?
Brut [27]
Because mutations do not always result in an amino acid change.
7 0
3 years ago
What would be the independent, dependent, and control variable to how coral dies? (100 points)
lozanna [386]

Answer:

in the explanation

Explanation:

The independent variable would be us humans polutling the ocean with oil and other plastics destroying the coral reefs. The dependant variable is an abbrasive species of fish becoming overpopulated and killing all the fish that help the coral grow causing the coral to die. (independant variable basically means humans tampering with it causing the problem. dependent is naturally occuring humans cant control whether a fish overpopluates or not thats natural)

8 0
2 years ago
What type of blood does the pulmonary artery transport?
Verizon [17]

Answer:

The pulmonary artery carries oxygenated blood from the right ventricle to the lungs. The blood here passes through capillaries adjacent to alveolar and becomes oxygenated as part of the process of respiration. In contrast to the pulmonary arteries, the bronchial arteries supply nutrition to the lungs themselves.

Explanation:

8 0
3 years ago
Read 2 more answers
Which organisms are most critical in the nitrogen cycle?
Strike441 [17]
These are the things that convert nitrogen in the soil -cyanobacteria<span>participate. After nitrogen has been fixed, other </span>bacteria<span> convert it into </span>nitrate<span>, in a process known as nitrification.</span>
8 0
3 years ago
Other questions:
  • Is a gel-like substance enclosed by the cell membrane that contains the cell's organelles
    15·2 answers
  • What is the answer???
    12·1 answer
  • What areas of the body are involved in the lymphatic system and how do they work
    9·2 answers
  • three species of northern American warblers are found to feed in different parts of the same spruce tree. This particular behavi
    12·2 answers
  • Which is an organism that belongs to the protista kingdom a)red algae b)caterpillar c) dandelion d) mushroom
    7·2 answers
  • What is the source, target, and action of erythropoietin
    7·1 answer
  • On what basis are rocks classified into three
    6·2 answers
  • How is it possible for mad made things to move?
    12·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Which of the following groups of organs all remove metabolic wastes from the human body?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!