1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Llana [10]
3 years ago
6

Which of the following is the main reason that humans need to include

Biology
1 answer:
zhuklara [117]3 years ago
3 0

Answer:

b

Explanation:

You might be interested in
David is taking a class about learning and motivation and he has to work in the laboratory two times a week teaching a rat to pr
joja [24]

Answer:

d. Skinner box

Explanation:

Skinner box provides an experimental condition that is used for examining natural flow of the behavior. It is also known with the other name as Operant conditioning chamber. It is a small chamber in which the animals for research are kept. Within the chamber there is a lever or key that the organisms under research can operate in order to get food or water in the chamber. An electronic equipment is connected to the chamber which records the activities of animals on keys or lever.

3 0
3 years ago
the saclike shape of lipocytes allowing them to store more fat is an example of The following them in biology structure to the f
valkas [14]

Explanation:

This is an example of relating structure to function.

Cells sharing a similar origin, group together in the body to form tissues; these typically share physical features and are arranged in regular patterns cells within the human body can generally be placed into four groups:

  • epithelial which refers to sheets of cells covering exterior surfaces and internal organs;
  • connective tissue which functions to bind cells and organs together while protecting, supporting and integrating different regions.
  • muscle tissue which responds to simulation, allowing for movement and locomotion;
  • nervous tissue which responds to electrical impulses, allowing for communication between different regions of the body

Connective tissue are usually spread out in a formation called a matrix. The matrix contains lots of extracellular components which are made by cells within connective tissue; it mainly consists of a fluid ground substance which interwoven with fibers of protein. Connective tissues mainly contain cells, the ground substance and protein fibers; each of these are present in varying amounts related to the structure and function of the tissue

It is further classified in to loose and dense tissue types which exists in multiple variations; in the loose tissue, fibers are aggregated loosely without a regular arrangement and often contains large spaces. Additionally connected tissue also contains cell types like fibroblasts. The loose tissue types, like adipose act as shock-absorbers and allow water, nutrients and salts to diffuse throughout the tissue  to nearby tissue and cells.

Lipid droplets found in lipocytes, are organelles made up of a core of hydrophobic lipids. This is encased in a single layer of phospholipids which arrange themselves tightly and efficiently in a ball, with their hydrophilic heads facing outwards; while their hydrophobic tails face inwards. The phospholipid monolayer may also contain embedded proteins that at as special signals for recognition.

In lipocytes, one of these droplets may take up the intracellular space (white adipose) with the nucleus pushed to one side of the spherical cell- the cell takes the shape of the droplet, which allows storage maximization. They make up a type of loosely aggregated connective tissue, called adipose tissue,which function in cell signalling, as energy storage, and insulation.

Learn more about cellular life at brainly.com/question/11259903

Learn more about tissue types at brainly.com/question/8487952

Learn more about homeostasis at brainly.com/question/1601808

#LearnWithBrainly

6 0
3 years ago
Read 2 more answers
Now it is time to do some word problems! In pea plants purple flower color is dominant over white flower color. A pea plant that
soldier1979 [14.2K]

Answer:

All the offsprings would be heterozygous purple colored flower

Explanation:

Given

Purple color flower is dominant over white color flower

Let the allele for purple color of flower be represented by "P"

and the allele for white color flower be represented by "p"

A pea plant that is homozygous purple-flowered is crossed with a pea plant that is white-flowered.

Genotype of homozygous purple-flower is "PP"

and Genotype of homozygous white-flower is "pp"

Cross between PP and pp produce the following offspring

PP * pp

Pp, Pp , Pp , Pp

All the offsprings would be heterozygous purple colored flower

5 0
3 years ago
Which describes a likely advantage of the roots that gymnosperms have? They are shallow, preventing the plants from growing too
vfiekz [6]

The roots of eh gymnosperms are long and deep, with the advantage to gather deep water. Thus, option D is correct.

Roots are the important network of tissues that gathers the water and essential nutrients from the soil and allow growth.

<h3>What type of roots are in Gymnosperms?</h3>

The gymnosperms are advanced plants with bare seeds. The roots system in the gymnosperms is the taproot system.

The root system in the gymnosperm is the long deep roots that are immersed deep inside the soil.

Thus, the advantage of roots to gymnosperms arises from the deep root for gathering water below the surface. Thus, option D is correct.

Learn more about gymnosperms, here:

brainly.com/question/4526473

6 0
2 years ago
Read 2 more answers
What do the rib muscles and diaphragm have in common?
Hatshy [7]

Answer:

Both are breathing muscles

Explanation:

When rib muscles and the diaphragm contract they increase the volume of the chest cavity, increasing the air pressure outside the body, causing air to rush into the lungs to fill the vacuum created by the increase in volume.

3 0
2 years ago
Other questions:
  • All sensory nerve impulses except smell are routed through the
    10·2 answers
  • Both high and low mass adult stars are classified as
    6·1 answer
  • A man who is an achondroplastic dwarf with normal vision marries a color-blind woman of normal height. The man's father was 6 fe
    12·1 answer
  • What part of the brain is the most posterior?
    12·1 answer
  • How does a cell interpret the genetic code 13.2?
    13·1 answer
  • Moshe is a writer. He is creating content for an informative chart to be placed near the coral reefs for the visitors to the ree
    10·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Why is maintaining homeostasis difficult
    6·1 answer
  • Describe one of the three types of volcanoes we discussed today
    14·1 answer
  • A daughter is talking with the urologist who is caring for the woman's 78-year-old mother. The mother has multiple sclerosis and
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!