Answer:
Negative feedback.
Explanation:
The production of erythropoietin by the liver and kidneys is a negative feedback because with the production of erythropoietin, our body tends to move to become more stable state. The erythropoietin is produced by the liver and kidneys to increase the production of red blood cells if the quantity of red blood cells are lower than the normal range. If the number of red blood cells are decreases the oxygen level in our body is low that leads to unstable condition of the body but when the concentration of red blood cells increases, the body move towards stability.
Answer:
The missing word is things.
However, the real question is how one material can serve so many purposes? That is what makes it possible for the spiders web to have a high "utility" value?
The answer is in how the spiders make the silk.
Explanation:
So it interesting to note that spiders do not make only one kind of silk. They vary depending on what purpose it's doing serve.
The most common type is Dragline Silk.
Dragline Silk: This contains spidroins. Spidroins fall under a category of a protein called scleroproteins. Because of its composition, a strand or fiber of Dragline has the same tensile strength as steel albeit more flexible. That is if one produced steel the diameter of a spider's silk, and compared both for strength, the silk will be stronger.
The spider produces Dragline silk in its silk glands where they are as viscous as a paste. From here is pulled out or extruded into lines of silk.
Other types of spider silk are:
- Capture-spiral silk. Also known as the Flagelliform, they are used for securing lines of the web. They are adhesive, very elastic, and possess high tensile strength.
- Tubiliform silk: They are also called Cylindriform. Its main use is for the protection of spider eggs. It is used to make a sac for which protects eggs. This type of silk is the toughest.
- Aciniform silk: For preserving fresh prey.
- Minor-ampullate silk: This type is used by spiders for creating temporary support while they are spinning a web. Etc.
Cheers
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Hermit crabs and giant tritons have a commensalism type of relationship.
