1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zalisa [80]
3 years ago
10

Which structure is responsible for bringing in the amino acids

Biology
1 answer:
zloy xaker [14]3 years ago
7 0

Answer:

The options to complete the question are

1

2

3

4

The answer is nothing else but 2.

You might be interested in
The stretch hold is a restraint technique:
siniylev [52]

Answer:

Option B,

Explanation:

Proper restraint and handling techniques are used while dealing with animals in laboratory. These techniques ease the process of dealing with animals and must be practiced on regular basis even when there is no procedure being performed.  

Unlike other animals cat is the most co-operative animals and it is usually dealt by restraining the body be one hand and head by other hand. Cats can also be restrained by holding the scruff with one hand and then gently holding the hind limbs followed by stretching it.

Hence, option B is correct.

7 0
3 years ago
Which material most likely has the highest level of permeability?
DiKsa [7]
Answer: C. Gravel
Gravel has the highest permeability.
7 0
3 years ago
Read 2 more answers
What is used to pass exciting electrons in the thylakoid membrane?
Minchanka [31]

Answer:

Photosystem I, however, does not act as a proton pump; instead, it uses these high-energy electrons to reduce NADP+ to NADPH. The reaction center chlorophyll of photosystem I transfers its excited electrons through a series of carriers to ferrodoxin, a small protein on the stromal side of the thylakoid membrane.

Explanation:

6 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Which of the following is the most likely impact of clearing a forest to construct a highway?
inn [45]

Possibility of acid rain will increase

3 0
2 years ago
Read 2 more answers
Other questions:
  • A group of 100 bomb blast victims were admitted to the hospital within an hour of the event. How should the hospital management
    13·1 answer
  • What does the lanrddcape look like​
    7·1 answer
  • Arrange the tiles to show the sequence of events in the development of the theory of evolution.
    11·1 answer
  • If you were a doctor, and a lab technician told you that the results of a patient’s lab test were Gram positive, what antibiotic
    9·1 answer
  • How do plants maintain homeostasis
    15·2 answers
  • What would happen if nitrogen-fixing bacteria were removed from the nitrogen cycle?
    11·1 answer
  • Sally has a large yard around her house how could she use that to live more sustainably
    13·2 answers
  • Question 10 5 pts Live or Die challenge (multiple answers): you are walking in the woods just with water and a Black Bear lookin
    11·1 answer
  • What is the major different between the particles in a liquid and a gas of the same substance at the same temperature? a The par
    15·1 answer
  • Which of the following is not a type of variable in a scientific experiment?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!