During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Answer:
B. They cannot capture other organisms
Answer:
Carbon dioxide enters the alveoli, and oxygen enters the capillaries.
Explanation:
This describes the exchange of gases in the lungs. When blood from the rest of the body gets to the lungs through the capillaries, oxygen flows from the alveoli which are tiny air sacs in the lungs, into the blood in the capillaries.
Carbon dioxide from the blood brought to the lungs will then flow into the alveoli which will then expel it through the nose. This repeated process ensures that the body keeps getting oxygen and expelling carbon dioxide.
Answer:
Their cell walls are composed of very different biochemicals.
Explanation:
Biological classification is important to classify the organisms on the basis of their similarities and differences between them. Linnaeus is known as the father of biological classification.
Cellwall plays an important role in the maintenance of structure and function of the organisms. The composition of the cell wall of fungi, plants and prokaryotes are quite different. Plants cell wall made of cellulose, fungi has chitin in its cell wall and prokaryotes has different layers of cell wall.
Thus, the correct answer is option (D).
The answer you are looking for is “Drought”.
