1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gizmo_the_mogwai [7]
3 years ago
8

Expanded form for 3,029,251

Mathematics
2 answers:
aliina [53]3 years ago
8 0
Try this : <span>3x10^6 + 2x10^4 + 9x10^3 + 2x10^2 + 5x10 + 1</span>
Arisa [49]3 years ago
5 0
3,000,000+20,000+9,000+200+50+1
You might be interested in
I don't get it- someone answer this, please.
creativ13 [48]

Answer:

<em><u>1.6</u></em>

Step-by-step explanation:

The Mean Absolute Deviation (MAD) is the distance each number is away from the mean divided by the amount of numbers.

15 is 4 away from 19, for example

So:

19 - 15 = 4

25 - 19 = 6

19 - 13 = 6

19 - 15 = 4

19 - 18 = 1

20 - 19 = 1

22 - 19 = 3

24 - 19 = 5

4 + 6 + 6 + 4 + 1 + 1 + 3 + 5 = 30

30/19 = 1.5789, rounded to 1.6

7 0
3 years ago
Read 2 more answers
Bill is a car salesman he earns $200 for every car he sales plus a 3% commission if Bill sells three cars in one week for a tota
Tom [10]
3 cars earns him $600.

(0.03)*$32,343 = $907.29 commission

total earnings = $907.29 + $600
= $1,507.29

3 0
3 years ago
Assume that y varies directly with x. If y = 16 when x = 8, find y when x = 5.
dem82 [27]

Answer:

Step-by-step explanation:

5y + x = 25

Subtract x from both sides when x = 5

5y + x - x = 25 - x

5y = 20

5y/5 = 20/5

=4

Y=4

6 0
2 years ago
Answer these four questions. Giving BRAINLIEST.
Alina [70]

Answer:

24

Step-by-step explanation:

because i said so

5 0
2 years ago
Need math help ASAP:)
PilotLPTM [1.2K]

Answer:

f(-2) = 4

Step-by-step explanation:

The function has three definitions depending on the value of x.

You are looking for the value of the function at x = -2.

-2 is in the interval x <= -1, which is the first line of the definition of the function.

We use the first line of the definition of the function.

f(x) = -2x for x <= -1

f(-2) = -2(-2) = 4

Answer: f(-2) = 4

5 0
3 years ago
Other questions:
  • What is the greatest common factor 12x^5 and 8x^3
    11·1 answer
  • Help please i’ll give brainliest
    12·1 answer
  • Which answer is it ?
    14·1 answer
  • What variable is isolated
    9·1 answer
  • Cari owns a horse farm and a horse trailer than can transport up to 8000 pounds of livestock and tack. She travels with 5 horses
    13·2 answers
  • NEED AN ANSWER ASAP!!!! Lines s and t are parallel. picture not drawn to scale What is the measure of ACB? A. 96° B. 143° C. 133
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • 7th grade math help me please :)
    5·2 answers
  • Can Someone Please Finish This Integers Page (I Really Need Help) ( 60 Points )!
    6·1 answer
  • 98. Of the students on the track team, 12 do the high jump. Of those students, 14 also do the long jump. What fraction of the st
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!