1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Wewaii [24]
3 years ago
13

Why are trophic levels often displayed as a pyramid?

Biology
1 answer:
Lynna [10]3 years ago
6 0
"B" 

This is most definetly the more legitimate answer choice than the other two... clearly...
You might be interested in
Pluto has a shape that is nearly round, and it orbits the Sun. It has five known moons. Why is it called a dwarf planet and not
TEA [102]

C. is the answer to the question

6 0
3 years ago
Remnants of erythrocyte nuclei, nuclear fragments, or aggregates of chromosomes are called:
Georgia [21]
Organelles? that'd be my geuss
7 0
3 years ago
What is the name of the tiny air sacs in your lungs?
yKpoI14uk [10]

Answer:

alveoli please leave brainliest

7 0
3 years ago
Read 2 more answers
Choose the event that correctly completes the flowchart showing how ATP is formed during photosynthesis.
Paladinen [302]
B) H+ ions flow out of the thylakoid.
3 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Other questions:
  • Sperm cells require approximately _______ to mature before they are ready for ejaculation.
    7·1 answer
  • In which of the following spheres of Earth does diffusion of carbon dioxide from the hydrosphere occur?. . Atmosphere. . Biosphe
    5·1 answer
  • List the stages of meiosis 1
    5·1 answer
  • Help!!!.................................
    13·1 answer
  • Look at the numbers used on the vertical axis. What
    15·1 answer
  • Where does the process of chemical digestion begins?
    7·2 answers
  • During cytokinesis, the cell membrane ________ until two daughter cells separate completely.
    9·1 answer
  • What is the correct answer I accidentally clicked echo
    14·1 answer
  • Which is larger - a water molecule or a sugar<br> molecule?
    7·1 answer
  • A nurse is caring for a client with a cerebral aneurysm. which nursing interventions would be most useful to the nurse to avoid
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!