1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
muminat
2 years ago
11

Which of the following is a disadvantage of genetic engineering?

Biology
1 answer:
kvv77 [185]2 years ago
8 0

Answer:

may cause negative side effects

Explanation:

You might be interested in
Plants, monera, and animals are all A.Have cell walls B. In the same kingdom C. In different kingdoms D. Have chloroplast
kupik [55]
A i think would be the best choice
6 0
3 years ago
Which factors would explain this pattern among predator and prey populations in this area?   Choose all answers that are correct
const2013 [10]
The answer is D. CD.
4 0
3 years ago
When the fertilized egg implants somewhere outside the uterus, this is called a(n)?
Romashka [77]
When the fertilized egg implants somewhere outside the uterus is called ectopic pregnancy 
.
7 0
3 years ago
What was the first eon of the Precambrian?A. PaleozoicB. HadeanC. PhanerozoicD. Archean
poizon [28]

Hadean is the first eon of precambrian, and took place around 4.6 and 4.0 billion years ago.

6 0
1 year ago
In which domain is the bottom of the DNA-binding cleft? What type of secondary structure lines the bottom of the cleft? In which
Archy [21]

Answer:

The bottom of the cleft is in the palm domain. It is lined with beta sheet.

Explanation:

During DNA synthesis, a single DNA strand is being built in by polymerization of nucleotides. These polymerization process is catalyzed by enzymes called DNA polymerase. These DNA polymerase can be visualized as an open right hand which is composed of a thumb domain, a finger domain and a palm domain. The palm domain contains a prominent beta-sheet that forms a plate at the button of the DNA-binding cleft.

8 0
3 years ago
Other questions:
  • Can someone answer these for me please I’m terrible at sex linked traits
    6·1 answer
  • The giant panda bear is an endangered species. Which natural behavior
    9·1 answer
  • How are the processes of photosynthesis and respiration related to one another?
    13·1 answer
  • What prevents wind from blowing in a straight line from the North Pole to the equator?
    15·1 answer
  • What parallels can you identify in the properties and effects of epinephrine and the plant hormone auxin?
    8·1 answer
  • Who invented aneroid barometer?
    14·1 answer
  • Two reefs are exposed to the black band disease pathogen. Reef A is located in a remote area off a rocky coast that receives lit
    10·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • The table shows the main food source of different organisms that make up a food chain.
    11·1 answer
  • All of the following are general functions of a plant's apical meristem except _ (blank) _. Select one: a. carries out cell divi
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!