1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maks197457 [2]
3 years ago
6

Does calcitriol also know as vitamin d stimulate secretion when the blood calcium is high or low?

Biology
1 answer:
Korolek [52]3 years ago
3 0

Answer: Calcitriol increases blood levels of calcium by increasing the absorption of calcium in the kidneys, increasing the absorption of calcium and phosphorus from the intestine, and increasing the release of calcium and phosphorus from the bones. Calcitriol helps the body to use calcium found in foods and supplements.

Explanation:

You might be interested in
When neither gene in a genotype pair is dominant and neither gene is recessive, the genes are said to be _____. multiple alleles
uranmaximum [27]
It is called incomplete dominance.
4 0
4 years ago
Read 2 more answers
Create a list of 5 potential jobs that students of neurology can obtain.
d1i1m1o1n [39]

Answer:

Explanation:

Machine Learning Engineer.

Neurosurgeon.

Neuroscience Researcher.

Pharmaceuticals Scientist.

Cognitive Neuroscientist.

8 0
3 years ago
Read 2 more answers
Tapeworms attach to the intestinal wall of sheep and absorb nutrients from the sheep's intestines. Which of the following best d
Andrej [43]

Answer:

It's A

Explanation:

7 0
3 years ago
Read 2 more answers
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
Reika [66]

Answer:

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

TTAAGCGGCCATAATCTGCAA

Explanation:

3 0
4 years ago
In a plant in which fuzzy leaves (f) are dominant over smooth leaves (), which of the following crosses will produce only offspr
Nina [5.8K]

Answer:

a

Explanation:

7 0
3 years ago
Other questions:
  • Oblique muscles are an example of which muscle feature?
    9·1 answer
  • The stomata you view on the surface of the leaves are used in gas exchange and the guard cells regulate this exchange. What do y
    12·1 answer
  • Specific molecule that an enzyme fits
    14·1 answer
  • Select the correct answer from each drop-down menu.
    13·1 answer
  • How does studying science help you be a better member of society? 1 point
    13·1 answer
  • Bats Devastated by Deadly Fungus
    5·1 answer
  • The area of the larger city is
    10·1 answer
  • Identify two organelle that convert energy in plants
    10·1 answer
  • What does population density measure?
    11·1 answer
  • Please help me with the following discussion questions for my biology experiment to determine the population of animals using a
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!