1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andru [333]
2 years ago
5

1) What is the full form of RBC and WBC ?​

Biology
2 answers:
REY [17]2 years ago
4 0

Answer:

What is the full form of RBC and WBC ?

RBC = Red blood cells

WBC = White Blood Cells

irina1246 [14]2 years ago
3 0

Answer:

RBC.Red blood cell

<h3>WBC.white blood cell..</h3>

You might be interested in
In which of the following ways do animals get the water that they need to survive? by eating plants and animals that contain wat
Goryan [66]
It is Choice B "by drinking water and other liquids"
7 0
3 years ago
Identify the statements that accurately describe how hydrogen ion concentration relates to energy production in oxidative phosph
ss7ja [257]

Oxidative phosphorylation relies on the hydrogen ion concentration gradient generated and maintained by the electron transport chain.

Hydrogen ions are actively transported out of the mitochondrial matrix.

Hydrogen ion concentration is higher in the intermembrane space than in the mitochondrial matrix.

4 0
3 years ago
What can be said about the maximum duration of lunar and solar eclipses?
Julli [10]
<span>Lunar eclipses-maximum duration
1 HR 40 min (total)
and
3 hours 40 minutes (partial-total-partial).<span>

Solar eclipse-maximum duration
7 min 40 Sec (total at the equator)
and
12 min 24 Sec for annular eclipses.</span></span>
5 0
3 years ago
Which component is released from the active site of an enzyme during a chemical reaction?
nalin [4]
Product
I hope this helps.
7 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • Which statement below is correct about the digestive system? A.The small intestine comes together with the stomach to form a tis
    13·2 answers
  • Hydrogen and carbon form non-polar bond. What relevance is<br> this<br> to living organisms?
    14·1 answer
  • The theory of endosymbiosis suggests that chloroplasts and mitochondria were once free-living prokaryotes, that were engulfed by
    7·2 answers
  • Do the spinal nerves include the sensory or motor neurons? Where do these neurons enter or exit the spinal cord?
    12·1 answer
  • How is E.coli like a paramecium?
    6·2 answers
  • Athletes with a high percentage of slow-twitch muscle fibers typically make better ________.
    5·1 answer
  • Many rainforests are found in the tropics, but only a few are found in cooler temperate zones. What makes a forest a rainforest?
    13·1 answer
  • Which of the following is an accurate description of the characteristics of prokaryotic cells?
    6·1 answer
  • Directions: Select the correct term or terms from the table. Different organisms have different traits, or characteristics. Some
    13·1 answer
  • In vertebrates, which structure frequently serves as the first intermediary between the areas of the brain that perceive sensory
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!