1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elis [28]
3 years ago
13

(last question) #5 Describe the different body senses and how they function.

Biology
2 answers:
Bad White [126]3 years ago
7 0

Answer:

Those senses are sight, smell, hearing, taste, and touch. We see with our eyes, we smell with our noses, we listen with our ears, we taste with our tongue, and we touch with our skin. Our brain receives signals from each of these organs, and interprets them to give us a sense of what's happening around us.

Explanation:

This is the best that I could do

Dahasolnce [82]3 years ago
3 0
Sight smell taste touch hearing
You might be interested in
The type of epithelium that lines the urinary bladder and may include some binucleated cells is called ____________ epithelium.
Leno4ka [110]
Transitional epithelium
4 0
2 years ago
a dive instructor begins his lesson on the shore. As he guides his students out into the water,what zone are they in?
Aleks04 [339]

PLATO USERS

Intertidal Zone 10 m (33 ft)

Sublittoral Zone 200 m (660 ft)

Hadal Zone 10,911 m (35,797 ft)

Bathyal Zone 6,000 m (19,686 ft)

[ a ] the sublittoral zone or the shallowest bathyal zone

[ b ] the intertidal zone or the deepest hadal zone

[ c ] the oceanic zone or the deepest intertidal zone

[ d ] <em><u>"The Intertidal Zone Or The Shallowest Sublittoral Zone."</u></em>

6 0
3 years ago
One strand of a DNA molecule has the base sequence GAGTTA. The complementary base sequence on the other strand of DNA will be
Olenka [21]
GAGTTA is what you have.
CTCAAT is what you’ll get.
A matches with T, G matches with C, and U is only for translating out of the DNA sequence.
4 0
2 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
The horseshoe crab breathes by means of its
DerKrebs [107]

Answer:

Book lungs

Explanation:

The horse shoe crab has a hard outer surface carapace which has the shape of a horse shoe.

It has book lungs which come in 5 sets. The lungs are usually found on the ventral side of the crab.

The book lungs acts as gills which is used in breathing when the horseshoe crab is in water . The book lungs also helps the crab to breathe on land for a certain period of time provided the lungs are moist.

3 0
3 years ago
Other questions:
  • Which of the following microorganisms is most likely to get its main source of nutrition from a host?
    14·2 answers
  • Rachel has a pessimistic attitude. She worries incessantly about things and can never seem to see the positive side of life. Acc
    14·1 answer
  • During adolescence, the mass and girth of the bones increases. Which of these could be the appropriate justification for this?
    11·1 answer
  • What type of mutation occurs when one base replaces another base in a DNA codon?
    13·1 answer
  • A means of expressing numbers as a multiple of two factors: a number between 1 and 10; and ten raised to a power, or exponent
    8·2 answers
  • Mold, a form of fungi, reproduces
    7·2 answers
  • Archaeopteryx is an intermediate fossil that has characteristics of both dinosaurs and early birds. This is evidence for evoluti
    10·2 answers
  • An image of an influenza virus is shown. The spike-like structures that cover the virus are surface proteins.
    9·1 answer
  • Why are people dum
    5·1 answer
  • From the roots up through the stems and into the leaves, replacing<br> the water used in ———— ??
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!