1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkinab [10]
2 years ago
5

What is the purpose of an organelle?

Biology
1 answer:
Mandarinka [93]2 years ago
6 0

Answer:

<em>Organelles are specialized structures that perform various jobs inside cells. The term literally means “little organs.” In the same way organs, such as the heart, liver, stomach, and kidneys, serve specific functions to keep an organism alive, </em><em>organelles serve specific functions to keep a cell alive.</em>

<em>Explanation:</em>

You might be interested in
A population is a group of organisms belonging to the same species that live in the same area and interact with one another.
worty [1.4K]

Answer:

A community

___________________________________________________________

5 0
3 years ago
How does a activity model competition
d1i1m1o1n [39]

Answer:

'?

its b

Explanation:

3 0
3 years ago
In facilitated diffusion, __________ proteins provide openings in the plasma membrane for substances to flow through without cha
denpristay [2]

Answer: CHANNEL PROTEINS provide openings in the plasma membrane for substances to flow through without changing structure, and CARRIER PROTEINS allow passage of substances through the plasma membrane after undergoing a subtle change in shape.

Explanation: They are described thus:

A channel protein is a protein that allows the transport of specific substances across a cell membrane.

Carrier proteins are proteins that carry substances from one side of a biological membrane to the other. Many carrier proteins are found in a cell’s membrane, though they may also be found in the membranes of internal organelles such as the mitochondria, chloroplasts, nucleolus, and others.

7 0
3 years ago
A water shed is
BlackZzzverrR [31]
I think its C also 
hope that helped : )
8 0
3 years ago
Read 2 more answers
What is the effect of defective or missing N-acetylglucosamine phosphotransferase on lysosomal protein sorting?
LiRa [457]

Answer:

The deficiency in this enzyme causes that it begins erroneously label other enzymes. Because the activating proteins are not properly labeled, they escape into spaces outside the cell and do not disintegrate substances inside the cells, that is, lysosomes cannot perform their function correctly. This causes waste products, which must include carbohydrates, lipids and proteins, accumulate in specific masses as inclusion bodies.

8 0
3 years ago
Other questions:
  • How does the human body maintain homerostasis
    5·1 answer
  • Chickens as Drug Factories
    11·1 answer
  • How did the environment of Arabia serve as a form of protection during much of the region's history?
    7·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The theory of plate tectonics includes blank types of plate boundaries.
    11·1 answer
  • What is the symbol for calcium
    14·2 answers
  • Fish rely on coral for
    8·2 answers
  • Anatomy: I need help!! If you know the answer pls let me know!! It would be greatly appreciated
    14·1 answer
  • Adaptations of cones and rodes
    7·1 answer
  • What is photosynthesis?Explain.​
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!