Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
1 cm to 1,00,000 cm. As 1 km represents 1,00,000 cm. That's why 1 cm to 1 km.
<u>Explanation:</u>
Scale represents the ratio between map distance and ground distance. Representative Fraction, Graphical scale, Linear scale and Comparative scale, Statement scale all are various categories of scale.
In Representative Fraction (R.F) values are represented in ratio format. Here, 1 cm map distance representing 1,00,000 cm ground distance. As 1 km= 1,00,000 cm. That's why 1 cm to 1 km means 1 cm map distance represents 1 km ground distance in reality.
Statement scale represents the values in a sentence. For eg. 1 cm to 1 km. Linear scale represents the values in primary and secondary divisions likewise Comparative scale compares two different units in a single scale.
Answer:
Use the map to answer the question. On a world map, countries with Proctor and Gamble facilities are shaded green. The largest sections of green on the map include North America, Australia, most of South America, most of Western Europe, several countries in Asia, and a few countries in Africa. Which of the following is a conclusion about this corporation that can be drawn from this map? A. This corporation promotes hierarchical diffusion from the United Kingdom, the United States, and China. B. This corporation relies on stimulus diffusion to expand its influence and profitability. C. This corporation’s resource acquisition is centered in North America. D. This corporation’s manufacturing operations affect all regions.
Explanation:
The answer should be the Grand banks of Newfoundland
Answer:
I'm probably late but I would like to say the answer is A) Mixed - Closer to Market
Explanation:
