<span>If there is not enough carbohydrate available in cells to allow the acetyl-CoA to enter the citric acid cycle, it will be used to make ketones. Acetyl-CoA is a molecule that is important in some biochemical reactions involving protein lipid and carbohydrate metabolism. It function to transport an acetyl group to the citric acid cycle or the Krebs cycle for it to be oxidized for the production of energy. Ketone can be produced and is regulated from the acetyl-CoA. The rate of the production of this substance would increase during starvation or in other words there is less carbohydrates that is available in the body.</span>
Answer:
The answer is A.
Explanation:
The inner ear parts are responsible for one of the most important sensory responsibilities in our body which is the keep us in balance and provide us with a sense of stability. It is made of three parts named semicircular canals, vestibule and cochlea.
The structure that contains the receptors mentioned in the question and helps us with our head movements to keep our heads horizontally and vertically in the correct position is called "The Saccule" and it is a part of the vestibule part of the inner ear.
I hope this answer helps.
A.)
causing less precipitation is not
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
gas, liquid, solid
Explanation:
I could also list 12 other states of matter if you're interested