1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marrrta [24]
3 years ago
12

Shawn is cooking and accidentally grabs the pan in the wrong spot and burns his hand. shawn's ability to rapidly pull his hand a

way from the pan is caused by his _____.
Biology
1 answer:
Kamila [148]3 years ago
8 0
The burning of his hand effecting the nerves in his hand and rapidly sending blood to the point if contact
You might be interested in
The new tools of genetic engineering allow us to manipulate __________ directly.
ch4aika [34]
DNA We can change how cells interact
4 0
4 years ago
Read 2 more answers
Which of the following is a disadvantage of geothermal energy?
Serga [27]
I’m pretty sure it’s b
7 0
3 years ago
How does osteoporosis affect the signal transduction pathway?
sdas [7]
The signal transduction pathways<span> recruited by the receptors of these hormones and growth factors </span>are<span> of particular interest.

Im not too sure about this might wanna check it.</span>
6 0
4 years ago
Score 5
irina [24]

Answer:

In medicine, genetic engineering has been used to mass-produce insulin, human growth hormones, follistim (for treating infertility), human albumin, monoclonal antibodies, antihemophilic factors, vaccines, and many other drugs. In research, organisms are genetically engineered to discover the functions of certain genes.

Explanation:

8 0
2 years ago
Read 2 more answers
All of the following are conditions that organisms in a tidepool must withstand except
NeX [460]
 d bc (a b c  and d) r the same to make a tidepool
3 0
3 years ago
Other questions:
  • For a species with four pairs of chromosomes, ________ gametic combinations are possible
    5·1 answer
  • Both the normal red blood cell and sickle cell alleles will make a protein that is made of how many amino acids
    10·1 answer
  • Which of the following representations shows how one variable changes in response to another variable
    14·1 answer
  • How do the products and reactants of a chemical change compare?
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • This scientist established a set of criteria to determine if a microbe is the cause of a specific disease.
    5·1 answer
  • If the three-base combination of T-C-G within a gene was in the process of DNA synthesis, what would be the complimentary base
    11·1 answer
  • PLEASE HELP!
    7·1 answer
  • Which of the following describes how the amount of available energy changes from one trophic level to another? A) Available ener
    15·1 answer
  • Describe how the sporophytes of hornworts differ from the sporophytes of mosses or liverworts​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!