1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
enyata [817]
2 years ago
8

PRODUCT 1 + PRODUCT 2 + enzyme​

Biology
1 answer:
mafiozo [28]2 years ago
3 0

Answer:

I'm not quite sure what it is you are asking, but if you mean the two components that make up an enzyme, that would be a protein and a non-protein, or a cofactor. A cofactor can be a cation or an organic molecule.

You might be interested in
Which group of words are energy sources for muscles?
devlian [24]
I would say D. Osteoarthritis, presbyopia 
7 0
3 years ago
In one of the first steps in Prophase I of meiosis,
Vikki [24]

Answer:

D) homologous pairs of chromosomes form tetrads

Explanation:

During prophase I, the homologous chromosomes condense and become visible as the x shape we know, pair up to form a tetrad, and exchange genetic material by crossing over.

5 0
3 years ago
Pls help ill give brainkliest and 5 stars
rewona [7]

Picture 1 depicts convergent boundary.

Picture 2 depicts divergent boundary.

Picture 3 depicts transform boundary.

<h3>What is a Divergent boundary?</h3>

This occurs when two tectonic plates move away from each other while convergent boundary occurs when the plates collide with each other.

Transform boundary is a fault along a plate boundary where the motion is mostly horizontal.

Read more about Divergent boundary here brainly.com/question/8866854

4 0
2 years ago
The single most important feature to consider when purchasing a scuba regulator is: How well it performs in controlled laborator
serg [7]

Answer:

A diving regulator is a pressure regulator that reduces the pressure of gas in the tank and deliver it to the diver so that he/she can breathe easily. It must pass the controlled laboratory testing and must have a second adjustment knob to ensure ease of breathing. Modern regulators are precision made and designed to work under demanding conditions. 1st stage and 2nd stage, diaphragm and piston, exhaust valve and purge button are types of diving regulators.

8 0
2 years ago
Evolution doesn't work according to any plan or change in any particular direction. Sometimes it leads to the rise of more compl
ANEK [815]
Well I think is a false estatement
7 0
2 years ago
Other questions:
  • 2.
    11·1 answer
  • Please help me out with this
    15·2 answers
  • Does anyone know this one ??
    9·2 answers
  • In your own words, explain why osmosis is really just a special case of facilitated diffusion
    6·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Preparation for genome are made in which phase​
    11·1 answer
  • Purple is dominant (G). Blue is recessive (g). What is the genotype of a heterozygous parent?
    6·1 answer
  • What is the complementary DNA for TACGGCTTA
    11·1 answer
  • Why do I not get sick when I eat cheese with holes in it, but I do get sick when I eat chicken that has gone bad?
    10·1 answer
  • What kind of neurotransmitter is serotonin ?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!