1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Iteru [2.4K]
4 years ago
10

A model helps scientists form testable hypotheses. What hypothesis was being tested with the ΔFus3 strain?

Biology
1 answer:
brilliants [131]4 years ago
6 0

Answer:

b. fus3 is required for the signal transduction pathway leading to shmoo formation.

Explanation:

This referes to the deductible hypothesis for the fus3 strain.

It should help us infer if the hypothesis should be upheld or discarded.

You might be interested in
Entrainment is the ability to or not to synchronize your breathing to your walking or running step.
wlad13 [49]
True

Entrainment is to synchronize an organism to an external whole for example music or tapping.

Hope this helps!
6 0
3 years ago
Read 2 more answers
The biological levels of organization range from a single cell all the way up to the biosphere in a highly structured hierarchy.
Tom [10]

Answer:

B) Tissue is made of different types of cells.

D) Organs are made of different types of tissue.

Explanation:

The tissues are made of different types of cells. The organs are also made of different types of tissue. There is no need of same types of tissues to make organs. Thus, option (B) and (D) is correct answer.

5 0
3 years ago
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
What is the process by which cells link monomers together to form polymers??
Black_prince [1.1K]
Dehydration synthesis is <span>the process by which cells link monomers together to form polymers</span>
8 0
3 years ago
Which of the following has contributed the most to the increase of invasive species in Europe?
Zielflug [23.3K]
Answer: A<span>n increase in trade across the continent. </span>
3 0
4 years ago
Other questions:
  • A normal adult's pulse pressure should range from _____ to _____ mm hg.
    13·1 answer
  • Which theory was first purposes by Albert Einstein
    8·2 answers
  • Are vaccines better than antibiotics?​
    13·1 answer
  • The science that describes populations is called _____. gerontology psychology demography geography
    8·2 answers
  • Which part of the body has enzymes that begin the process of breaking down starch molecules?
    8·1 answer
  • Staphylococcus aureus is grown in heart-infusion broth at 37°C. If you start exponential phase with 100 cells, and after 90 minu
    15·1 answer
  • Question no. 80 answer please
    8·1 answer
  • PLEASE HELP<br> what would happen if a lot of the animals are going to be extinct??
    6·2 answers
  • Please help meh i will give brainliest
    8·2 answers
  • ¿Crees que el cromosoma Y contiene genes que son críticos para la supervivencia de un organismo? Explica tu razonamiento
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!