1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yulyashka [42]
2 years ago
5

A sea star can make its stomach come out of its mouth. agree or disagree

Biology
2 answers:
kicyunya [14]2 years ago
5 0

Answer:

its true or agree

Explanation:

Most sea stars also have the remarkable ability to consume prey outside their bodies. Using tiny, suction-cupped tube feet, they pry open clams or oysters, and their sack-like cardiac stomach emerges from their mouth and oozes inside the shell

avanturin [10]2 years ago
4 0

Answer:

Starfish have a feeding method that is unlike any other. To eat, the echinoderm ejects its stomach from its own body — placing it over the digestible parts of its prey, typically a mussel or clam.

Explanation:

hope this helps

You might be interested in
Help ASAP!! (2 questions)
Aleksandr-060686 [28]

Animals get carbon by eating plants or by eating other animals.

so the correct answer would be C

The lion eats an herbivore that ate the grass

Plants use carbon dioxide for photosynthesis. By doing so, they remove inorganic carbon from the atmosphere and incorporate it into the plants’ tissues in the form of organic carbon (sugar and starch).

Carbon is returned to an inorganic state in a number of ways. As an animal breathes (respires), it exhales carbon dioxide, returning it back to the atmosphere. When an animal or plant dies, it is broken down by bacteria and fungi and again the carbon is released (this process is called decomposition).

Sometimes, instead of completely decomposing, a plant or animal may be fossilised, leading to its carbon being stored in a rock. After millions of years and under the right conditions, these fossils may turn into fossil fuels (oil, coal and natural gas).

hope this helps!!

5 0
3 years ago
1. Where is potential energy in a car kept?
valkas [14]

Answer: The gasoline

Explanation: Gasoline is potential chemical energy because it is only used when the car is in use. It becomes kinetic when the car is on.

3 0
3 years ago
Fibers linking the __________ to the __________ grow and myelinate from birth through the preschool years, contributing to drama
jarptica [38.1K]
Your answer is c<span>erebellum; cerebral cortex.</span>
4 0
3 years ago
How do animals get their nutrients
Phoenix [80]

Answer:

Most animals obtain their nutrients by the consumption of other organisms. At the cellular level, the biological molecules necessary for animal function are amino acids, lipid molecules, nucleotides, and simple sugars. However, the food consumed consists of protein, fat, and complex carbohydrates.

Explanation:

4 0
3 years ago
Read 2 more answers
Explain why the structure of DNA is described as a double helix
Hatshy [7]

Answer:

The double helix is the description of the structure of a DNA molecule. A DNA molecule consists of two strands that wind around each other like a spiral staircase. Each chain has a backbone in which a sugar (deoxyribose) and a phosphate group alternate.

8 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Agribusiness is the concept of small farms selling crops each year to earn a meager living.
    13·1 answer
  • Consider the aquatic phosphorus cycle. On land most phosphorus is found in rocks and minerals. In the oceans, phosphorus is depo
    14·2 answers
  • Environmental microbiology... A. ...shows great promise, but has not yielded any significant discoveries yet. B. ...includes met
    6·1 answer
  • Type of tissue provides protective barriers for the body
    12·2 answers
  • Using the graphic provided, identify the products of photosynthesis.
    6·1 answer
  • How many molecules of eDNA would result from one molecule after three cycles of PCR
    10·2 answers
  • Closure is the process of A. finding proximity B. finishing a sensation C. interacting with our senses. D. filling in missing pa
    7·2 answers
  • Blood leaves the left ventricle through the vessel known as:
    6·1 answer
  • Explain the biological structure hierarchy of the human body and the role of homeostasis in maintaining the body. Include the fo
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!