1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IRINA_888 [86]
2 years ago
15

B. If the fly experienced a force of 100 N when it hits, how big was the force

Biology
1 answer:
lions [1.4K]2 years ago
7 0

Answer:

I think you answered your own question

You might be interested in
We consume significant amounts of what vitamin in an inactive form?
Art [367]
Vitamin A; it is a soluble vitamin in fatty bodies, which can not be released in the urine as other vitamins normally do, it is said that we consume large quantities in an inactive form since this is necessary for many human body processes such as vision, formation and maintenance of skin cells, the immune system, growth and even lactation and embryonic development, therefore it is not necessary to be active to consume large amounts of this vitamin.
6 0
3 years ago
How many electrons fulfill each shell of the elemental structures
Agata [3.3K]
It takes 8 electrons to fill a shell.
7 0
3 years ago
Read 2 more answers
Water is essential for life on Earth. Which property of water is the primary reason water is able to transport substances to and
alexgriva [62]
I'm not sure if there are answer choices, but water is an excellent solvent, taking along valuable nutrients with it when it travels.
7 0
2 years ago
In humans (and other animals) where does glucose come from?
Maru [420]

Answer:

Glucose is a carbohydrate, and is the most important simple sugar in human metabolism. ... Glucose is one of the primary molecules which serve as energy sources for plants and animals. It is found in the sap of plants, and is found in the human bloodstream where it is referred to as "blood sugar"

Explanation:

5 0
2 years ago
Read 2 more answers
What happens in your body to cause you to get a fever?
andriy [413]

The presence of a fever is usually related to stimulation of the body's immune response. Fever can support the immune system's attempt to gain advantage over infectious agents, such as viruses and bacteria, and it makes the body less favorable as a host for replicating viruses and bacteria, which are temperature sensitive. Infectious agents are not the only causes of fever, however. Amphetamine abuse and alcohol withdrawal can both elicit high temperatures, for example. And environmental fevers--such as those associated with heat stroke and related illnesses--can also occur.

The hypothalamus, which sits at the base of the brain, acts as the body's thermostat. It is triggered by floating biochemical substances called pyrogens, which flow from sites where the immune system has identified potential trouble to the hypothalamus via the bloodstream. Some pyrogens are produced by body tissue; many pathogens also produce pyrogens. When the hypothalamus detects them, it tells the body to generate and retain more heat, thus producing a fever. Children typically get higher and quicker fevers, reflecting the effects of the pyrogens upon an inexperienced immune system.

4 0
3 years ago
Other questions:
  • Wyatt and Darnell are designing an experiment to study water mold reproduction. Water mold is an example of a protist that repro
    9·2 answers
  • Which is a heterogeneous mixture? the water, vinegar, and dye mixture used to make colored eggs the mixture of gases in the air
    12·2 answers
  • In mitochondria, synthesis of ATP uses a proton motive force that is used to
    6·1 answer
  • Which experiment is more likely to be reliable, and why ?
    5·1 answer
  • Many people want to live in urban areas. One of the main factors that limits the number of people that can live in an area is A.
    11·2 answers
  • Birds have hollow bones. explain how this is adaptive.
    14·1 answer
  • Select all of the answers that apply.
    15·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What does a degree of longitude equal in kilometers at the equator
    8·1 answer
  • What is the full form of ATP???????????????????????​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!