1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maksim231197 [3]
2 years ago
14

Which of the following are key features of prokaryotic cells? Select all that apply -ribosomes -cell wall. -nucleoid. -endoplasm

ic reticulum. -plasmid
Biology
2 answers:
astraxan [27]2 years ago
4 0

1st, 3rd, 5th

-ribosomes, nucleoid, plasmid

mezya [45]2 years ago
3 0

Answer:ribosomes

cell wall

plasmid

Explanation:

You might be interested in
Bacteria and humans are similar in that they both
Minchanka [31]
They both need nutrients and are able to reproduce 
7 0
3 years ago
Read 2 more answers
What are some ides you have heard of for climate change
GenaCL600 [577]

Answer:

Ans:

Explanation:

Make your voice heard by those in power. ...

Eat less meat and dairy. ...

Cut back on flying. ...

Leave the car at home. ...

Reduce your energy use, and bills. ...

Respect and protect green spaces. ...

Invest your money responsibly. ...

Cut consumption – and waste.

hope it helps ....please mark brainliest

8 0
2 years ago
Which of the following is not a type of asexual reproduction?
insens350 [35]

Answer:

Fertilization

Explanation:

Binary fission is when single parent cell doubles it’s DNA, then divides into two cells. (usually in bacteria).

Budding is the small growth on surface of parent breaks off, resulting in formation of two individuals. (ex: yeast)

Fragmentation is when organisms break into two or more fragments that develop into a new individual. (occurs in many plants and some animals like starfish)

7 0
2 years ago
In the post-absorptive state (e.g. 10 hours after a meal), which is not likely to occur?
GaryK [48]
I found the exercise on the internet and these are the options:
"<span>a. gluconeogenesis begins
b. beta-oxidation increases
c. blood glucose levels fall
d. the liver produces more glycogen"

The option that's not likely to happen is "</span>the liver produces more glycogen".
The formation of glycogen by the liver happens after eating a meal with carbohydrates. The level of blood glucose increases, and insulin is secreted by the pancreas and will act by allowing glucose to enter the body cells. When the glucose enters the liver cells, insulin will also act on the liver by stimulating glycogen synthesis. This process continues to happen until glucose levels begin to decrease in the <span>post-absorptive state</span> and, therefore, insulin secretion also decreases leading glycogen synthesis in the liver to stop.
6 0
3 years ago
In this simple food chain, the organism that converts solar energy into usable chemical energy is missing. that would be the?
eduard
A producer or something like grass or plants..
5 0
3 years ago
Read 2 more answers
Other questions:
  • The hospice nurse is visiting the wife of a client who died 10 months ago. the wife states, "my life is meaningless since my hus
    9·1 answer
  • What city does sunrise occurs in first each day??
    14·1 answer
  • What is the result when DNA ligase has completed its job?
    12·1 answer
  • Opportunistic bacteria _____.
    15·2 answers
  • Whats does a cell meaning in biology
    9·2 answers
  • Which is most likely the order of the origin of life on Earth?
    15·1 answer
  • What 3 things do autotrophs<br> need for photosynthesis?
    15·2 answers
  • Why are the lungs made up of these
    8·1 answer
  • How can structures for movement help protists to survive
    15·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!