1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anyanavicka [17]
3 years ago
14

Predict imagine that a fence perpendicularly crosses a transform plate. Draw diagrams o the fence and the two plates before and

after the plates move. Use arrows to show the direction of movement of the plates
DRAW IT please... thanks! with explanation :)
Biology
1 answer:
Maurinko [17]3 years ago
7 0

Answer:

dunno

Explanation:

You might be interested in
How high is the ceiling in a school gym if a volleyball thrown upward from the floor at 15 m/s barely touches the ceiling before
Harman [31]

The height of the ceiling in the school gym from the floor is 11.48m.

HOW TO CALCULATE HEIGHT OF A PROJECTILE:

  • Using one of the equations of motion as follows:

v² = u² + 2as

Where;

v = final velocity (m/s)

u = initial velocity (m/s)

a = gravitational acceleration (m/s²)

s = distance traveled (m)

According to this question,

  • The final velocity (v) of the volleyball is 15m/s
  • The initial velocity is 0m/s
  • The acceleration due to gravity is 9.8m/s

Using the formula, v² = u² + 2as, the height of the ceiling (s) can be calculated as follows:

15² = 0² + 2 (9.8) (s)

225 = 0 + 19.6s

225 = 19.6s

s = 225/19.6

s = 11.48m

Therefore, the height of the ceiling in the school gym from the floor is 11.48m

Learn more: brainly.com/question/21065813

5 0
3 years ago
Read 2 more answers
n Drosophila melanogaster, forked bristles are caused by an allele (Xf) that is X linked and recessive to an allele for normal b
makkiz [27]

Answer:

Proportion of the F2 male with red eyes and forked bristle will be 1/4

Explanation:

forked bristles are caused by an allele (Xf) that is X linked and recessive to an allele for normal bristles (X+).

Brown eyes are caused by an allele (b) that is autosomal and recessive to an allele for red eyes (b+)

A female fly that is homozygous for normal bristles and red eyes mates with a male fly that has forked bristles and brown eyes

    X+X+b+b+  x    Xfbb

the F1 gives   1/2X+Xf 1/2b+b

                      1/2X+Y  1/2b+b

intercross of F1

      Proportion of the F2 male with red eyes and forked bristle will be

      forked bristle= Xfy = 1/2 and for red eyes  2/4= 1/2  = 1/2x1/2 =1/4

6 0
3 years ago
if the concentration of a sugar solution is lower outside the cell than inside the cell which will happen by osmosis?
Svetach [21]
Water leaves the cell because the cell is in a hypertonic solution.
3 0
3 years ago
True or False: Food Webs are generally more accurate and detailed models of an ecosystem than Food Chains.
ICE Princess25 [194]

Answer:

True

Explanation:

They have more options and possible ways

7 0
3 years ago
Read 2 more answers
Which of the following abiotic factors can influence the number of plants that can grow in an ecosystem?
AnnyKZ [126]

Answer: The most important abiotic factors for plants are light, carbon dioxide, water, temperature, nutrients, and salinity.

8 0
3 years ago
Other questions:
  • The first organisms on Earth were able to transform the carbon dioxide in the air into what essential element needed for modern
    6·2 answers
  • What does the Diagram of the water intake by a Bryophyte look like?
    8·1 answer
  • Does covering your mouth with cloth protect you from chemicals
    8·1 answer
  • Name the eight levels of classification from most general to most specific
    14·2 answers
  • Which measure of the center is most affected by the really low score
    12·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Please help what's the answer <br> What's a good find and know
    12·2 answers
  • How did Scientist find the human gene that makes insulin
    10·1 answer
  • I need help!
    11·2 answers
  • If a person is suffering from severe dehydration and does not have enough water in his or her cells, a physician might give the
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!