1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Korolek [52]
2 years ago
6

What procedure did you use to complete the lab? Outline the steps of the procedure in full sentences. (This is about Relative an

d Absolute dating)
Biology
1 answer:
igomit [66]2 years ago
4 0

Procedures that needs to be considered to complete the lab are- a thorough knowledge of lab assignments, knowledge about safety equipment,  reviewing the MSDS of chemicals for lab experiment etc.

Explanation:

To be lab prepared one must follow these procedures-

1. One should have the knowledge of lab assignments to make the lab experiment easier.

2. To be aware about safety equipment and their uses in lab, like- the location of fire extinguisher in lab.

3. To know the steps of experiments to be performed

4. To fill notebook of lab with information regarding the experiment

5. One should review the data sheets of chemicals material safety.

6. To put on all the necessary dressings to perform experiment.

7. To have complete understanding about the experiment disposals.

You might be interested in
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
Measure of an organisms’s ability to survive and produce offspring relative to other members of a population
marishachu [46]

Fitness.

Explanation:

Fitness is a relative thing.A genotypes' fitness include its ability to survive,find a mate,produce off spring.

5 0
3 years ago
Name one molecule that DOES NOT pass through the cell membrane easily
stellarik [79]

Answer:

glucose

Explanation:

Small nonpolar molecules, such as O2 and CO2, are soluble in the lipid bilayer and therefore can readily cross cell membranes. Small uncharged polar molecules, such as H2O, also can diffuse through membranes, but larger uncharged polar molecules, such as glucose, cannot.

5 0
3 years ago
Read 2 more answers
Where do convection currents occur.
-Dominant- [34]

Answer:

the answer is C-in areas with different air pressures

Explanation:

Convection occurs when particles with a lot of heat energy in a liquid or gas move and take the place of particles with less heat energy. Heat energy is transferred from hot places to cooler places by convection. Liquids and gases expand when they are heated.

3 0
4 years ago
Read 2 more answers
5. Energy may be supplied by both
FromTheMoon [43]
The carbohydrates, fats and proteins we eat and drink provide calories for us (and alcohol as well if we choose to consume it). Sometimes people refer to these nutrients as "energy yielding".
5 0
2 years ago
Other questions:
  • Barrier islands form as the direct result of _____.
    11·2 answers
  • Jelaskan pengertian dari insekta, dan sebutkan contoh nya.
    9·1 answer
  • What process in meiosis ensures that daughter cells will be genetically different from parent cells?
    10·1 answer
  • Despite being farther away from the sun than Mercury, Venus has a much warmer temperatures. What accounts for Venus is temperatu
    14·1 answer
  • Cells within an organism can be very different from one another. for example, human red blood cells are filled with hemoglobin,
    12·2 answers
  • What is the difference between a cell and a tissue?
    8·1 answer
  • Mechanical weathering can be caused by _________. Select all that apply. A. gravity B. acid rain C. freezing and thawing in the
    12·2 answers
  • Can someone pls determine who do you believe is the murderer? and just a brief explanation as well.
    14·1 answer
  • Photosynthesis and Cellular Respiration
    12·1 answer
  • Find 10 words associated with the properties of gases?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!