1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexxandr [17]
2 years ago
11

Which of the following are functions of proteins?

Biology
1 answer:
Butoxors [25]2 years ago
6 0

Answer:

qbgfgb

Explanation:

You might be interested in
Identify two factors that have changed the relationship between people and their environment, resulting in the production of pol
Alik [6]
Technology and industrialization are two top ones.
3 0
3 years ago
The spleen and the thymus work together to fight infection. These organs together make up which next level of organization?​
lisabon 2012 [21]

I’m looking for this too, ain’t no way your in collage learning this.

6 0
3 years ago
What is short day plant?​
Gekata [30.6K]

Answer:

\huge\boxed{Answer\hookleftarrow}

✐ A plant that requires a long period of darkness, is termed a "short day" (long night) plant. Short-day plants form flowers only when day length is less than about 12 hours. Many spring and fall flowering plants are short day plants, including chrysanthemums, poinsettias and Christmas cactus.

____________________

ʰᵒᵖᵉ ⁱᵗ ʰᵉˡᵖˢ

# ꧁❣ RainbowSalt2²2² ࿐

3 0
3 years ago
____ are species whose roles have a large effect on the types and abundance of other species in an ecosystem.​
Ksju [112]

Keystone species are species whose roles have a large effect on the types and abundance of other species in an ecosystem. Keystone species are important in the ecosystem as they help to determine the whole ecosystem and without them, the ecosystem would be different or stop to be in existence. Almost all animals that have a significant impact on the food webs are examples of keystone species.






4 0
3 years ago
Read 2 more answers
A single piece of coiled DNA is know as a?
JulsSmile [24]
A single piece of coiled DNA is called a plasmid. 
7 0
3 years ago
Other questions:
  • A man has blood type O, Rh negative. These are both recessive traits. He is married to a woman who has blood type A, Rh positive
    8·1 answer
  • What typepersonal protective equipment used in the lab proctects the eyes?
    11·1 answer
  • When either trait in a dihybrid cross is homozygous recessive, what is that gene?
    11·1 answer
  • A small 21 kilogram canoe is floating downriver at a speed of 3 m/s. What is the canoe's kinetic energy?
    14·1 answer
  • Lists 3 characteristics that are used to describe air
    10·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Plants store excess sugars as<br> known as cellulose?
    6·1 answer
  • When neurotransmitters latch onto the receptors on the ____ of the receiving neuron, tiny gates in the receiving cell's membrane
    10·1 answer
  • 4. Where do spore cases reside on ferns?
    14·2 answers
  • What is the only bone not connected to any other bone?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!