1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetlana [45]
3 years ago
8

What’s European identity?

Geography
2 answers:
Lyrx [107]3 years ago
7 0

Answer: European identity is the sense of personal identification with Europe, in a cultural or political sense.

Explanation:

Artyom0805 [142]3 years ago
7 0

Answer:

The sense of personal identification with Europe, in a cultural or political sense.

Explanation:

The most defensible conception of a common European identity has something to do then with stable and reciprocal practices of identification between all or most inhabitants of a given territorial space. ... Despite clear efforts by the EU institutions to cultivate them, they remain rather thin on the ground.

Plz Mark me brainlist

You might be interested in
Locations near the equator are
WINSTONCH [101]
<span>Locations near the equator are warmer in temperature always. </span>
4 0
4 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
On the diagram what evidence suggests that this valley is situated in the southern hemisphere ​
ollegr [7]

Answer:

attach the diagram pls..........

4 0
2 years ago
I need help please ASAP
frez [133]
The answer is (A) 2 2/3
3 0
3 years ago
Read 2 more answers
Ctions
KonstantinChe [14]

Answer:72 seeds of corn in section one

Explanation:my estimate is simple.

I assumed 6 rows in a section., And in one row 4 portion.

And 3 seeds to be planted together.

So total is 3*4*6=72 .

So in any section , the number of seeds is approximately 72 to 84 if the number of rows increases to 7.

5 0
4 years ago
Other questions:
  • The end of Soviet censorship has allowed Russians to enjoy a wider variety of _____.
    14·2 answers
  • Which of the following events belongs in Box B on the chart above?
    11·2 answers
  • The Northwestern European Plain is used mainly for agriculture.
    5·2 answers
  • Looking at the heat circulation in the ocean, what might happen to it if large amounts of cold water are added in the polar regi
    14·2 answers
  • What role did social media play in politics in Iran in 2009?
    5·2 answers
  • Una bahía está rodeada de tierra en __________ lado (s).
    6·1 answer
  • A marine climate is generally characterized by
    15·1 answer
  • Explain the main cause of the change in direction of the monsoon wind​
    9·1 answer
  • Which two layers of the Earth are considered liquid
    9·2 answers
  • do you think governments should have a plan or procedure in place to deal with the movement of the continents? why or why not
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!