1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
son4ous [18]
3 years ago
5

If you were born November 16, 1986 how old are you today

Biology
2 answers:
Strike441 [17]3 years ago
5 0

Answer:

2021-1986 = 35 years old

Explanation:

AlexFokin [52]3 years ago
4 0
Answer
You say
2021-1986
The person is 35 years old

Hope this helps :)
You might be interested in
8. All the abiotic and biotic factors that interact with each other is called
3241004551 [841]

Answer:a niche

Explanation:

5 0
3 years ago
Read 2 more answers
Which career combines DNA technology and medicine?
Goshia [24]
Genetics combines Dna, technology, and agriculture 

8 0
3 years ago
Read 2 more answers
Is the flower is pink an inference
Travka [436]
It is D because you are inferring the rest are statements the dog barking you can obviously hear it vinegar has a pungent aroma you can smell it. the flower is pink you can see it. but a cup with steam coming from it will be hot to the touch. it says "Will be" which implies that you haven't actually touched it yet. I know which question your talking about.
6 0
3 years ago
In which biome would you be most likely to find plants and animals that are
vlabodo [156]

Answer:

I'm pretty sure the answer is a Tundra.

Explanation:

It's the only biome that has snow out of every other answer choice. Snowy places are naturally cooler than humid ones.

7 0
3 years ago
Which of these items would be a renewable resource?
scZoUnD [109]
Fish would be renewable since they can be reproduced.

We cant make gold, or oil, and gasoline comes from oil, so all are non-renewable

3 0
3 years ago
Read 2 more answers
Other questions:
  • Explain why the temperature of water stays the same for a while once it starts boiling?
    6·2 answers
  • Which rays of the electromagnetic spectrum do we feel as heat is transferred between Earth and the atmosphere?
    12·1 answer
  • I was finishing Summer B Plato Biology for High School when the program closed. All I had left to finish was my final. Does anyo
    7·1 answer
  • How can coral bleaching directly or indirectly affect other population?
    7·1 answer
  • Proteins that speed up chemical reactions without being used up or destroyed in the process are called
    5·2 answers
  • Which of the statements best describes the process of crossing over during meiosis? Haploid daughter cells trade chromosomes in
    5·1 answer
  • Which of the following is not true about lipids plz answer
    14·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What are 2 conditions to enhance infant memory?
    6·1 answer
  • Circulation to and from the lungs is referred to as
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!