1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tems11 [23]
3 years ago
6

Active transport requires energy from the cell. A True B False​

Biology
2 answers:
Sindrei [870]3 years ago
8 0

Answer:

A

Explanation:

active transports moves things against the gradient so it requires energy

passive transport diffuses with the gradient so it doesn't require energy

Vladimir [108]3 years ago
3 0

Answer:

A TRUE

Explanation:

You might be interested in
An ecologist who is studying the relationships among the dominant communities in a geographical region is studying a biome. plea
navik [9.2K]
It is true that a<span>n ecologist who is studying the relationships among the dominant communities in a geographical region is studying a biome.
A biome is a group of ecosystems that have the same climate and similar dominant communities, so you can see that the answer to this question is T.</span>
3 0
3 years ago
Read 2 more answers
"3. explain the direction of blood flow and the type of blood (oxygenated or deoxygenated) found in each vessel in the pulmonary
Alex_Xolod [135]
The blood flows through the vessels of the heart to keep it going
4 0
3 years ago
N NaO2, what does the 2 represent?
Viktor [21]

Answer:

In the element (<u>n Na20)</u> the <em>2 </em>means that there are 2 oxygen atoms in the Sodium Oxide.

7 0
3 years ago
WILL PICK BRAINLIEST!!
Lady_Fox [76]
I think C would be correct
7 0
3 years ago
¿Verdadero o falso?
max2010maxim [7]

Answer:

ambot sa imoa uy mag goggle ka

4 0
3 years ago
Other questions:
  • Scientists want to determine how closely related chimpanzees are to humans. Which data would give the MOST accurate comparison?
    7·2 answers
  • Which activities of the body are controlled by the central nervous system?
    10·2 answers
  • _______ is the process where unstable atomic nuclei spontaneously transform into another element.
    14·2 answers
  • _______ is located in the anterior neck produces key hormones for metabolism
    14·1 answer
  • Researching the question "Should we dissect?"
    15·1 answer
  • OLEAS EHELP!!!
    11·1 answer
  • 15 POINTS!!
    10·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • When an object is already in motion, why is energy required to stop it
    11·1 answer
  • you go on an expedition into the amazon rainforest to look for new species before they are destroyed by logging. you find one or
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!