1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrMuchimi
3 years ago
7

During carbohydrate catabolism, more atp molecules are produced during

Biology
1 answer:
IgorC [24]3 years ago
3 0

Answer: Glycolysis

Explanation:

It changed glucose to acid.

You might be interested in
What other structures are found in plants that allow for the exchange of gases? (other than the stomata)
Galina-37 [17]
Roots and stems

Explanation: the cork of mature roots and woody stems is perforatedby nonsuberized pores called lenticels.
4 0
3 years ago
A penny lies in the bottom of a tea cup filled with water. As you look down on the penny, compared to its actual depth, it looks
-BARSIC- [3]

Answer:

I think its the first one The penny absorbs the light as it enters the cup.

Explanation:

I hope this helps u! :D

8 0
3 years ago
The powerhouse of the cell: that is a term used to describe the ______________, because it's main function is to produce energy
const2013 [10]

Answer: Mitochondria

Explanation:

The power house of the cell is known as Mitochondria. The energy that is required by the body is provided by mitochondria.

The hydrolysis of the ATP takes place in which it is converted into ADP and Pi and some amount of energy is released.

This energy is used by the body for the various types of metabolic activities. The site of ATP formation is mitochondria.

8 0
3 years ago
Read 2 more answers
State the basic requirement of sexual
lesya692 [45]

The requirements for sexual reproduction, is that the species has both a Male and Female gender if they are both this also still applies as long as they don't breed with themselves.Sexual reproduction helps prevent disfigurements, that can end up killing an entire generation of animals and also can lead to a species adapting to environments faster.

4 0
3 years ago
Read 2 more answers
Which two layers of the atmosphere are responsible for the majority of the solar radiation absorption
bixtya [17]
The answer is the stratosphere and the the thermosphere ( b)
5 0
3 years ago
Read 2 more answers
Other questions:
  • What is the best definition of directional selection
    12·2 answers
  • Which statement best describes the age of the seafloor?
    11·1 answer
  • "In genetic modifications, DNA inserted can come from _____ ." any organism containing the DNA of interest only the same plasmid
    15·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which star will most likely have heavier elements such as iron, silicon, oxygen, neon, and carbon in its core?
    5·1 answer
  • Help ASAP will give brainilest
    15·2 answers
  • A biologist in pennsylvania observes the interactions of populations of maple trees, mosses, eastern spotted skunks, peregrine f
    13·1 answer
  • What are four different properties of magnets
    7·2 answers
  • Which are parts of a seed?
    13·1 answer
  • Cells of an organism perform the following chemical reaction: 6 CO2 + 6 H2O + → C6H12O6 + 6 O2 To which organism do these cells
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!