1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiv31 [10]
3 years ago
14

12. Which is NOT a natural cause of extinction?

Biology
1 answer:
sveticcg [70]3 years ago
7 0

Answer:

12.B

17. A

11. C

13. B

16. A

7. B

8. B

19. D

23. B

You might be interested in
Which of the following landmarks is found on the posterior surface of the scapula?
Sonbull [250]

Answer:

The correct option is C. Spine is present on the posterior surface of the scapula

Explanation:

The scapula is a triangular bone that joins humerus with the clavicle.

The landmarks present on the posterior surface of the scapula are:

1. Spine: The spine of the scapula divides it into two parts.

2. Acromion: This is the landmark that connects with the clavicle.

3. infraspinous fossa: This landmark is present underneath the spine and the infraspinatus muscle is located here.

4. Supraspinous fossa: It is the landmark that is situated on top of the spine.

       

8 0
3 years ago
How does interphase prepare a cell to divivde?
Ira Lisetskai [31]
The interphase prepares the cell to divide by enlarging the cell so that when it does divide, there will be space for the nucleus (if it applies to the cell) and the organelles. It will allow the cell to be able to function and later divide on its own. It replicates DNA so that the two future daughter cells will have an even number of chromosomes to remain the cell type that it's parent was.

Hope this helped!
5 0
3 years ago
3 advantages and disadvantages of the natural ecosystem<br>​
Andrei [34K]

Answer:

Urbanization has environmental and economic advantages for humans, but also substantial disadvantages, including increased problems with physical and mental health/stress, a modified climate, water and energy management, and air pollution.

7 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Help please!!
sdas [7]

Answer:

Better healthcare

Rise in birthrate

Food security

Lack of awareness/ education

Cultural influences

Lack of family planning

Religious propagation

Malicious intent to change demographics

Immigration

For Social support

Perception of marriage & family.

Explanation:

This rapid population growth has an adverse effect on the natural resources and quality of life.

However, overpopulation has a deleterious effect on the environment due to the current lifestyle.

There would be rampant exploitation of natural resources, excess human waste accumulation, chances of epidemics, etc.

Besides, it would also lead to socio-economic problems like poverty, malnutrition, violence, corruption, etc.

Human overpopulation occurs if the number of people in a group exceeds the carrying capacity of the region occupied by that group.

6 0
3 years ago
Other questions:
  • Nutrients form digested food move from the digestive system directly into the
    5·1 answer
  • How does an enzyme speed up a chemical reaction? Enzymes:
    9·1 answer
  • This simple bacteria cell has the same structure as more complex cells. It controls what comes in to and leaves the cell and als
    14·2 answers
  • Mr. Burns, a retired neighbor of Roger's, is angry at Roger for playing loud music. Roger, who is 9 years old, notices that it i
    7·1 answer
  • What is the primary function of the calvin cycle?
    6·1 answer
  • The rapid speciation of mammals as a result of the availability of new habitat due to the extinction of the dinosaurs 65 million
    6·1 answer
  • In incomplete dominance, both alleles are expressed in offspring. true or false
    7·1 answer
  • What was the variable in Pasteur's experiment?
    7·2 answers
  • In a healthy person, after a large meal, the production of _____ will increase. after fasting, the production of _____ will incr
    6·1 answer
  • Besides organic pollutants, dead zones are also affected by nitrogen compounds. Denitrifying bacteria in the anoxic dead zones c
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!