1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PIT_PIT [208]
2 years ago
12

DNA is know as the molecule of life because it

Biology
1 answer:
wlad13 [49]2 years ago
6 0

Often referred to as the molecule of life, DNA (deoxyribonucleic acid) is found in almost all living things. It acts as a type of chemical code that contains instructions, known as genes, for how the body and all its different parts grow, develop, function, and maintain themselves.

You might be interested in
What molecules are made during transcription
Softa [21]

Answer:

During transcription, only one strand of DNA is usually copied. This is called the template strand, and the RNA molecules produced are single-stranded messenger RNAs (mRNAs). The DNA strand that would correspond to the mRNA is called the coding or sense strand

Explanation:

6 0
2 years ago
Read 2 more answers
How many significant digits are there in 0.00840, 15.7, and 13.040?
skelet666 [1.2K]

Answer:

3sf, 3sf, 5sf

Explanation:

hope it helps!!!

3 0
3 years ago
What are the products of aerobic respiration?
3241004551 [841]
Products of aerobic respiration would be water and carbon dioxide
3 0
3 years ago
What does phloem do?
Luda [366]

Answer:

Main function of phloem Transportation of food particles.

Explanation:

Phloem is the living vascular tissue in plants. Phloem is also known as bast. Phloem is responsible for transporting food to parts of the plant where needed. It's mainly transport sugar sucrose which is made by photosynthesis. This transport process is called translocation. In trees the phloem is the innermost layer of the bark.

5 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Other questions:
  • Explain the main idea of the article in detail.
    15·2 answers
  • Your 23-year-old brother has never been interested in exercising. He has a rather fast metabolism and has never gained any weigh
    8·1 answer
  • In which kingdoms are both unicellular and multicellular organisms found?
    15·2 answers
  • Sterol and stanol esters, also go by the name ________________, and help lower blood ______________.
    9·2 answers
  • How do cells relate to your genes and how can cells differentiate into the specific body parts?
    5·1 answer
  • What should be done after listing the options when making good health decisions? ASAP FOR A GRADE ANSWER: Identify the consequen
    7·2 answers
  • How much unsaturated fatty acids are present in butter?
    5·1 answer
  • Why do silent mutations not affect the protein that the gene encodes?
    11·1 answer
  • An egg is protected by its outer shell. However, the shell also allows moisture and air to pass through. Which cell structure pe
    6·1 answer
  • Proteins help the body build new tissue, repair damage cells, and produce energy.
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!