1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gwar [14]
3 years ago
10

The double walled membranous sac that encloses the heart is the

Biology
1 answer:
gtnhenbr [62]3 years ago
8 0
THIS IS known as the PERICARDIUm
You might be interested in
Shifting plant populations are an example of biological change.A change in temperature is a physical change.Why do biological an
MA_775_DIABLO [31]

Answer:

Organisms depends on physical and biological factors of an ecosystem.

Explanation:

Biological and physical changes cause shift in an ecosystem's populations because the population of organisms depends and greatly affected from the environmental factors such as temperature, moisture etc. These environmental factors causes change in the physical features of an ecosystem so when these changes occur in physical factors, it greatly affected the population of organisms.

3 0
3 years ago
What is the topic of The Five Second Rule science experiment
Mademuasel [1]
Its that food dropped on the ground is safe to eat and will not be covered in germs as long as its picked up within 5 seconds after its dropped.
5 0
3 years ago
What does the prefix "hetero-" mean?<br>A. Same<br><br>B. Different
disa [49]
I would say different
Like you like different genders
4 0
3 years ago
Read 2 more answers
HELP PLEASE EXPLAIN<br><br><br> I will give brainliest whoever explains
Sergeu [11.5K]

Answer:

active transport

Explanation:

they are using energy to move across the membrane, using energy means its active   Hope this helps

6 0
2 years ago
Read 2 more answers
Which terrestrial biome has abundant rainfall?
enot [183]

The biome that has over 100 inches of rain each year is the Rainforest. Therefore, the Rainforest has abundant rainfall.


5 0
3 years ago
Other questions:
  • In cellular respiration, stored chemical energy in
    6·2 answers
  • What is it called when bacteria take in DNA from their environment?
    11·2 answers
  • In 1900, there were approximately 1.75 billion humans on earth; in 1950, there were approximately 2.3 billion; in the year 2025,
    13·1 answer
  • animal cells do not have cell walls since animals have other means of physical support, such as the skeleton. What would be the
    10·2 answers
  • Which human activity is most affected by increasing numbers of dead zones in the ocean
    12·1 answer
  • Why do all chemical reactions require activation energy?
    8·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Scientific Process , Describe its importance
    9·1 answer
  • What do we call the speed needed for a projectile (like a cannonball) to overcome the force of Earth's gravity?
    6·2 answers
  • Please help i’ll give that brain thing if you answer correctly thanks! :)))
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!