Answer:
Erythropoietin is the answer hope it helps
emilythompson35464
hope this helps tho srry if it doesn't
Answer:
The rabbit population helped the fox population go up but caused the rabbi9t population to go down.
Explanation:
<u>Answer:</u><u>All of the above</u>
<u />
<u>Explanation: Reason being is because the cell membrane protects the cell, that's what is really important about it's function. But all of the following is true too.</u>
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Because they dont want to kill the grass or the plants that they want. but only to kill the plants its meant for