1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
galben [10]
2 years ago
15

What are Negative health effects of frequent, self-induced vomiting?

Biology
1 answer:
Damm [24]2 years ago
5 0

Answer: It can rot your teeth out because of the stomach acid.

Explanation:

You might be interested in
Which of the following represents types of aquatic mammals from most aquatic to least aquatic?
dolphi86 [110]

Answer:

I would say polar beats

Explanation:

As polar bears actually don't have to get in water..

Not sure ok sorry

5 0
3 years ago
What three features of seabirds are specifically adaptive for life at sea
Ilya [14]
1.Beak for catching prey
2.Wings to fly away from danger
3. Ability to balance
7 0
2 years ago
Chloroplasts are found in __________. chloroplasts are found in __________. neither plant cells nor animal cells animal cells on
lapo4ka [179]
Plant cells and some Protists
3 0
3 years ago
Read 2 more answers
How much atp is produced from a single glucose molecule in each reaction set?
drek231 [11]
30 ATP is produced from a single glucose molecule
7 0
2 years ago
Which lists the substances from least acidic to most acidic
brilliants [131]

Answer:

a. ammonia, blood, milk, orange juice

b. orange juice, milk, blood, ammonia

c. ammonia, milk, blood, orange juice

d. orange juice, blood, milk, ammonia

Explanation:

PLEASE MARK ME AS BRAINLIEST!!!!

8 0
2 years ago
Other questions:
  • Water covers most of Earth’s surface. The diagram shows the structure of a water molecule.
    7·1 answer
  • What is a retrovirus
    6·2 answers
  • What is the article What’s the Buzz? How Bees Interrelate with Birds, Wildflowers, and Deer By John muir about
    15·1 answer
  • We should be taking every step we can to protect our health. Getting vaccinated against bacterial meningitis will help protect o
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • I need help understanding
    6·1 answer
  • I’ll give brainliest :) !!<br><br> Root hairs, a part of the root tissue system, does what?
    9·1 answer
  • According to the food web shown, which group below lists only secondary consumers?
    15·1 answer
  • Which important event in Earth’s history occurred during the Jurassic period?
    5·1 answer
  • 3y-6x=-6Put the following equation of a line into slope-intercept form, simplifying all fractions.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!